Incidental Mutation 'R5399:Mybpc1'
ID429882
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Namemyosin binding protein C, slow-type
Synonyms8030451F13Rik, Slow-type C-protein
MMRRC Submission 042970-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock #R5399 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88518279-88605152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88523014 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 343 (V343A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119185
AA Change: V1091A

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: V1091A

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121629
AA Change: V1105A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: V1105A

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148205
Predicted Effect probably damaging
Transcript: ENSMUST00000153964
AA Change: V343A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122472
Gene: ENSMUSG00000020061
AA Change: V343A

DomainStartEndE-ValueType
PDB:2YUW|A 2 52 2e-25 PDB
low complexity region 53 65 N/A INTRINSIC
IG 68 151 9.06e-2 SMART
FN3 154 236 2.06e-12 SMART
IGc2 281 348 1.88e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156573
SMART Domains Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
PDB:1X44|A 2 58 1e-26 PDB
IG 66 146 6.97e-3 SMART
IG 159 244 2.83e-3 SMART
FN3 247 330 4.28e-10 SMART
FN3 345 446 1.6e-9 SMART
low complexity region 458 470 N/A INTRINSIC
IG 473 556 9.06e-2 SMART
FN3 559 617 8.17e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G T 2: 152,440,868 L214F probably damaging Het
Abcb1b T C 5: 8,827,410 S657P probably benign Het
Abcb5 T A 12: 118,911,499 Y646F probably benign Het
Agl A T 3: 116,781,628 L620Q probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Arhgap23 A G 11: 97,500,917 N1420S probably damaging Het
Arntl2 T G 6: 146,822,661 D350E probably damaging Het
Barx2 A G 9: 31,854,111 probably null Het
Birc6 C A 17: 74,604,578 S28R possibly damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Casp4 A T 9: 5,324,928 K247* probably null Het
Clk4 T C 11: 51,275,257 Y17H probably damaging Het
Cntnap1 A G 11: 101,183,316 Q722R probably benign Het
Col6a6 A G 9: 105,709,107 V1905A possibly damaging Het
Csmd1 C A 8: 16,710,597 G174V probably damaging Het
Cul1 T A 6: 47,485,084 probably null Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Dnaaf2 A G 12: 69,196,742 I515T probably damaging Het
Fbn1 T C 2: 125,332,333 I1868V possibly damaging Het
Fcgbp G T 7: 28,105,055 V1863L probably benign Het
G2e3 T C 12: 51,357,194 probably null Het
Gabrr2 T C 4: 33,071,458 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gbgt1 C T 2: 28,503,218 P106L probably damaging Het
Gm13023 T C 4: 143,795,032 F406S probably benign Het
Gm6657 A C 12: 78,197,453 N60T probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,205,024 E927G probably damaging Het
Hfm1 T A 5: 106,917,562 I84F possibly damaging Het
Htt G T 5: 34,877,151 D1989Y probably damaging Het
Ihh C T 1: 74,946,277 A350T probably benign Het
Irx4 G C 13: 73,265,539 A43P probably benign Het
Itk A G 11: 46,338,111 V414A probably benign Het
Itsn2 A T 12: 4,653,535 I744L probably benign Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif14 A G 1: 136,503,324 D1153G probably benign Het
Morc3 A G 16: 93,862,539 probably null Het
Msc A T 1: 14,755,556 C65S probably benign Het
Myo5c T C 9: 75,288,074 I1218T possibly damaging Het
Mypn C T 10: 63,120,186 V1163I probably benign Het
Obox3 A T 7: 15,626,288 M152K probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1204 T A 2: 88,852,655 L235H probably damaging Het
Olfr1264 T A 2: 90,021,923 T48S probably benign Het
Olfr328 A G 11: 58,552,143 V32A probably benign Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prss23 A T 7: 89,509,966 D298E probably benign Het
Rab4b A T 7: 27,176,162 N31K probably benign Het
Ros1 A G 10: 52,090,944 probably null Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Rtl1 A T 12: 109,590,302 L1701Q probably damaging Het
Sbno1 T A 5: 124,392,741 N831Y probably benign Het
Selp A G 1: 164,126,586 K152E possibly damaging Het
Sema4b A G 7: 80,224,886 T675A probably benign Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Slco1a4 T A 6: 141,830,707 I196F probably damaging Het
Spata13 G A 14: 60,747,541 S828N probably benign Het
Stard13 A T 5: 151,047,801 Y643* probably null Het
Tll1 T C 8: 64,085,488 H374R probably damaging Het
Trmt10a T A 3: 138,147,504 I42K probably damaging Het
Trmu A T 15: 85,896,408 probably null Het
Trp53 T A 11: 69,588,546 D183E probably benign Het
Ttc22 T G 4: 106,636,757 F305V probably damaging Het
Unc13c A G 9: 73,749,688 F1077S possibly damaging Het
Utrn T A 10: 12,640,983 Q2289L probably damaging Het
Vmn1r65 C A 7: 6,008,810 E142* probably null Het
Vmn2r63 A T 7: 42,928,277 V279D probably benign Het
Zfp810 G A 9: 22,278,829 T261I possibly damaging Het
Zkscan17 A G 11: 59,502,918 probably null Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88549262 missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88536384 missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88525108 splice site probably null
IGL00964:Mybpc1 APN 10 88555742 critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88570645 missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88531770 missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88536428 missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88526373 missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88540960 missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88571516 splice site probably benign
R1321:Mybpc1 UTSW 10 88529541 missense possibly damaging 0.85
R1321:Mybpc1 UTSW 10 88570601 missense probably damaging 1.00
R1562:Mybpc1 UTSW 10 88553331 missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88553295 missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88548826 missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88551542 missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88546059 missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88573437 nonsense probably null
R2129:Mybpc1 UTSW 10 88551452 missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88540942 splice site probably benign
R2200:Mybpc1 UTSW 10 88555695 missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88555678 missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88551407 missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88531779 missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88570659 splice site probably null
R4032:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88573525 nonsense probably null
R4821:Mybpc1 UTSW 10 88548865 missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88522991 missense probably benign
R4876:Mybpc1 UTSW 10 88536424 missense probably benign 0.03
R4878:Mybpc1 UTSW 10 88551430 missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88555724 nonsense probably null
R4913:Mybpc1 UTSW 10 88553254 critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88555663 missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88543774 missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88546064 missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88536351 missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88546029 missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88570566 missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88542456 missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88568619 missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88560355 missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88553277 missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88522999 missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88536381 missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88542330 nonsense probably null
R6972:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88523024 missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88553412 missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88543719 missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88549347 missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88526293 missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88549325 missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88548854 missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88542372 missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88558667 missense probably damaging 1.00
R7961:Mybpc1 UTSW 10 88537642 intron probably null
Z1176:Mybpc1 UTSW 10 88560327 missense probably benign
Z1177:Mybpc1 UTSW 10 88573437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATACAGAGGCAGAGGTGTCC -3'
(R):5'- GCTTTTAAATCCCACTGCTGG -3'

Sequencing Primer
(F):5'- AGAGGTGTCCTGTCTGTCCC -3'
(R):5'- ACATCGTAGGCTTTGACTTGAC -3'
Posted On2016-09-06