Incidental Mutation 'R5399:Abcb5'
ID 429898
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene Name ATP-binding cassette, sub-family B member 5
Synonyms 9230106F14Rik
MMRRC Submission 042970-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R5399 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 118831559-118930156 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118875234 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 646 (Y646F)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
AlphaFold B5X0E4
Predicted Effect probably benign
Transcript: ENSMUST00000035515
AA Change: Y646F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: Y646F

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100982
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G T 2: 152,282,788 (GRCm39) L214F probably damaging Het
Abcb1b T C 5: 8,877,410 (GRCm39) S657P probably benign Het
Agl A T 3: 116,575,277 (GRCm39) L620Q probably damaging Het
Anapc15 C T 7: 101,547,810 (GRCm39) P68L probably damaging Het
Arhgap23 A G 11: 97,391,743 (GRCm39) N1420S probably damaging Het
Barx2 A G 9: 31,765,407 (GRCm39) probably null Het
Birc6 C A 17: 74,911,573 (GRCm39) S28R possibly damaging Het
Bmal2 T G 6: 146,724,159 (GRCm39) D350E probably damaging Het
Btbd19 G A 4: 116,980,957 (GRCm39) A104V probably damaging Het
Casp4 A T 9: 5,324,928 (GRCm39) K247* probably null Het
Ccdc196 A C 12: 78,244,227 (GRCm39) N60T probably damaging Het
Clk4 T C 11: 51,166,084 (GRCm39) Y17H probably damaging Het
Cntnap1 A G 11: 101,074,142 (GRCm39) Q722R probably benign Het
Col6a6 A G 9: 105,586,306 (GRCm39) V1905A possibly damaging Het
Csmd1 C A 8: 16,760,613 (GRCm39) G174V probably damaging Het
Cul1 T A 6: 47,462,018 (GRCm39) probably null Het
Cux1 T C 5: 136,281,458 (GRCm39) E568G possibly damaging Het
Dnaaf2 A G 12: 69,243,516 (GRCm39) I515T probably damaging Het
Fbn1 T C 2: 125,174,253 (GRCm39) I1868V possibly damaging Het
Fcgbp G T 7: 27,804,480 (GRCm39) V1863L probably benign Het
G2e3 T C 12: 51,403,977 (GRCm39) probably null Het
Gabrr2 T C 4: 33,071,458 (GRCm39) probably null Het
Gad1-ps G A 10: 99,281,009 (GRCm39) noncoding transcript Het
Gbgt1 C T 2: 28,393,230 (GRCm39) P106L probably damaging Het
Golga3 A G 5: 110,352,890 (GRCm39) E927G probably damaging Het
Hfm1 T A 5: 107,065,428 (GRCm39) I84F possibly damaging Het
Htt G T 5: 35,034,495 (GRCm39) D1989Y probably damaging Het
Ihh C T 1: 74,985,436 (GRCm39) A350T probably benign Het
Irx4 G C 13: 73,413,658 (GRCm39) A43P probably benign Het
Itk A G 11: 46,228,938 (GRCm39) V414A probably benign Het
Itsn2 A T 12: 4,703,535 (GRCm39) I744L probably benign Het
Kdm5b G A 1: 134,549,836 (GRCm39) probably null Het
Kif14 A G 1: 136,431,062 (GRCm39) D1153G probably benign Het
Morc3 A G 16: 93,659,427 (GRCm39) probably null Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Msc A T 1: 14,825,780 (GRCm39) C65S probably benign Het
Mybpc1 A G 10: 88,358,876 (GRCm39) V343A probably damaging Het
Myo5c T C 9: 75,195,356 (GRCm39) I1218T possibly damaging Het
Mypn C T 10: 62,955,965 (GRCm39) V1163I probably benign Het
Obox3 A T 7: 15,360,213 (GRCm39) M152K probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or2t47 A G 11: 58,442,969 (GRCm39) V32A probably benign Het
Or4c106 T A 2: 88,682,999 (GRCm39) L235H probably damaging Het
Or4c3 T A 2: 89,852,267 (GRCm39) T48S probably benign Het
Pcdhb21 G T 18: 37,648,772 (GRCm39) V634L probably benign Het
Ppp1r9b G A 11: 94,882,974 (GRCm39) A201T probably benign Het
Pramel25 T C 4: 143,521,602 (GRCm39) F406S probably benign Het
Prss23 A T 7: 89,159,174 (GRCm39) D298E probably benign Het
Rab4b A T 7: 26,875,587 (GRCm39) N31K probably benign Het
Ros1 A G 10: 51,967,040 (GRCm39) probably null Het
Rragb G A X: 151,923,550 (GRCm39) G24E probably damaging Het
Rtl1 A T 12: 109,556,736 (GRCm39) L1701Q probably damaging Het
Sbno1 T A 5: 124,530,804 (GRCm39) N831Y probably benign Het
Selp A G 1: 163,954,155 (GRCm39) K152E possibly damaging Het
Sema4b A G 7: 79,874,634 (GRCm39) T675A probably benign Het
Slc36a3 T C 11: 55,037,006 (GRCm39) I100V possibly damaging Het
Slco1a4 T A 6: 141,776,433 (GRCm39) I196F probably damaging Het
Spata13 G A 14: 60,984,990 (GRCm39) S828N probably benign Het
Stard13 A T 5: 150,971,266 (GRCm39) Y643* probably null Het
Tll1 T C 8: 64,538,522 (GRCm39) H374R probably damaging Het
Trmt10a T A 3: 137,853,265 (GRCm39) I42K probably damaging Het
Trmu A T 15: 85,780,609 (GRCm39) probably null Het
Trp53 T A 11: 69,479,372 (GRCm39) D183E probably benign Het
Ttc22 T G 4: 106,493,954 (GRCm39) F305V probably damaging Het
Unc13c A G 9: 73,656,970 (GRCm39) F1077S possibly damaging Het
Utrn T A 10: 12,516,727 (GRCm39) Q2289L probably damaging Het
Vmn1r65 C A 7: 6,011,809 (GRCm39) E142* probably null Het
Vmn2r63 A T 7: 42,577,701 (GRCm39) V279D probably benign Het
Zfp810 G A 9: 22,190,125 (GRCm39) T261I possibly damaging Het
Zkscan17 A G 11: 59,393,744 (GRCm39) probably null Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118,854,345 (GRCm39) missense probably benign 0.03
IGL00092:Abcb5 APN 12 118,892,430 (GRCm39) missense probably benign 0.09
IGL00503:Abcb5 APN 12 118,871,336 (GRCm39) missense probably benign 0.02
IGL00776:Abcb5 APN 12 118,883,589 (GRCm39) missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118,849,911 (GRCm39) missense probably benign
IGL01302:Abcb5 APN 12 118,881,935 (GRCm39) missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118,836,602 (GRCm39) missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118,831,705 (GRCm39) missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118,875,169 (GRCm39) missense probably benign 0.03
IGL01784:Abcb5 APN 12 118,854,399 (GRCm39) missense probably benign 0.14
IGL01967:Abcb5 APN 12 118,831,707 (GRCm39) missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118,891,093 (GRCm39) missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118,904,415 (GRCm39) missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118,838,490 (GRCm39) missense probably benign
IGL02292:Abcb5 APN 12 118,881,932 (GRCm39) missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118,904,413 (GRCm39) missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118,870,003 (GRCm39) splice site probably benign
IGL02685:Abcb5 APN 12 118,869,682 (GRCm39) missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118,854,420 (GRCm39) missense probably benign 0.05
IGL02876:Abcb5 APN 12 118,883,576 (GRCm39) missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118,908,674 (GRCm39) missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118,904,104 (GRCm39) missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118,899,822 (GRCm39) missense probably benign 0.43
IGL03200:Abcb5 APN 12 118,928,989 (GRCm39) splice site probably benign
IGL03407:Abcb5 APN 12 118,904,111 (GRCm39) missense probably benign 0.01
alphabet UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
google UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
F5770:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118,899,833 (GRCm39) missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118,854,422 (GRCm39) missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118,891,129 (GRCm39) missense probably benign
R0219:Abcb5 UTSW 12 118,849,885 (GRCm39) splice site probably benign
R0312:Abcb5 UTSW 12 118,836,572 (GRCm39) missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118,928,986 (GRCm39) splice site probably benign
R0359:Abcb5 UTSW 12 118,904,067 (GRCm39) missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118,841,545 (GRCm39) missense probably benign 0.03
R0582:Abcb5 UTSW 12 118,904,147 (GRCm39) missense probably benign 0.40
R0815:Abcb5 UTSW 12 118,865,184 (GRCm39) splice site probably benign
R0900:Abcb5 UTSW 12 118,904,359 (GRCm39) missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118,869,933 (GRCm39) missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118,896,310 (GRCm39) missense probably benign 0.36
R1125:Abcb5 UTSW 12 118,875,282 (GRCm39) missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118,838,497 (GRCm39) missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118,929,064 (GRCm39) start gained probably benign
R1726:Abcb5 UTSW 12 118,871,267 (GRCm39) missense possibly damaging 0.95
R1726:Abcb5 UTSW 12 118,838,536 (GRCm39) splice site probably null
R1836:Abcb5 UTSW 12 118,831,696 (GRCm39) missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118,871,235 (GRCm39) splice site probably null
R1976:Abcb5 UTSW 12 118,854,417 (GRCm39) missense probably benign
R2005:Abcb5 UTSW 12 118,841,562 (GRCm39) missense probably benign 0.15
R2068:Abcb5 UTSW 12 118,904,303 (GRCm39) nonsense probably null
R2181:Abcb5 UTSW 12 118,831,681 (GRCm39) missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118,831,691 (GRCm39) missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118,836,668 (GRCm39) missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118,838,355 (GRCm39) missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118,865,087 (GRCm39) splice site probably null
R3919:Abcb5 UTSW 12 118,854,353 (GRCm39) missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118,832,404 (GRCm39) missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118,836,657 (GRCm39) missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118,896,345 (GRCm39) critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118,929,040 (GRCm39) missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118,875,169 (GRCm39) missense probably benign 0.03
R4966:Abcb5 UTSW 12 118,850,626 (GRCm39) intron probably benign
R5169:Abcb5 UTSW 12 118,841,552 (GRCm39) nonsense probably null
R5327:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R5333:Abcb5 UTSW 12 118,831,677 (GRCm39) missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118,831,665 (GRCm39) missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118,850,912 (GRCm39) missense probably damaging 1.00
R5416:Abcb5 UTSW 12 118,871,331 (GRCm39) missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118,891,061 (GRCm39) missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118,904,425 (GRCm39) missense probably null 1.00
R5566:Abcb5 UTSW 12 118,899,702 (GRCm39) missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118,896,348 (GRCm39) splice site probably null
R5691:Abcb5 UTSW 12 118,890,970 (GRCm39) missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118,881,992 (GRCm39) missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118,891,139 (GRCm39) missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118,832,516 (GRCm39) nonsense probably null
R5994:Abcb5 UTSW 12 118,928,995 (GRCm39) critical splice donor site probably null
R6295:Abcb5 UTSW 12 118,838,379 (GRCm39) missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118,854,284 (GRCm39) critical splice donor site probably null
R6609:Abcb5 UTSW 12 118,892,497 (GRCm39) missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118,908,641 (GRCm39) missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118,865,089 (GRCm39) splice site probably null
R6870:Abcb5 UTSW 12 118,929,000 (GRCm39) missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118,875,265 (GRCm39) missense probably benign 0.06
R6957:Abcb5 UTSW 12 118,871,270 (GRCm39) missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118,891,012 (GRCm39) missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118,895,660 (GRCm39) missense probably benign 0.00
R7061:Abcb5 UTSW 12 118,841,509 (GRCm39) missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118,831,611 (GRCm39) missense probably benign 0.00
R7239:Abcb5 UTSW 12 118,892,460 (GRCm39) missense probably benign 0.19
R7267:Abcb5 UTSW 12 118,916,205 (GRCm39) missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118,875,295 (GRCm39) missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118,831,609 (GRCm39) missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118,881,899 (GRCm39) missense probably damaging 1.00
R7989:Abcb5 UTSW 12 118,875,278 (GRCm39) missense probably benign 0.01
R8177:Abcb5 UTSW 12 118,836,525 (GRCm39) missense possibly damaging 0.65
R8296:Abcb5 UTSW 12 118,838,467 (GRCm39) missense probably benign 0.01
R8544:Abcb5 UTSW 12 118,832,461 (GRCm39) missense probably damaging 1.00
R8558:Abcb5 UTSW 12 118,841,566 (GRCm39) missense probably benign 0.07
R8790:Abcb5 UTSW 12 118,831,620 (GRCm39) missense possibly damaging 0.91
R9003:Abcb5 UTSW 12 118,850,013 (GRCm39) missense possibly damaging 0.93
R9038:Abcb5 UTSW 12 118,895,651 (GRCm39) missense probably benign
R9410:Abcb5 UTSW 12 118,869,703 (GRCm39) missense probably benign 0.00
R9497:Abcb5 UTSW 12 118,899,850 (GRCm39) missense probably damaging 0.96
R9666:Abcb5 UTSW 12 118,838,422 (GRCm39) missense probably damaging 0.98
R9682:Abcb5 UTSW 12 118,896,328 (GRCm39) missense probably damaging 0.99
R9756:Abcb5 UTSW 12 118,881,873 (GRCm39) missense probably damaging 0.98
V7580:Abcb5 UTSW 12 118,849,914 (GRCm39) missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118,882,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGCAAACGCTTTGTGA -3'
(R):5'- ACATCCTCACCTTCCAACTG -3'

Sequencing Primer
(F):5'- CAAACGCTTTGTGAACTTAGTGGC -3'
(R):5'- ACAAGCACTTTGGCAGCTG -3'
Posted On 2016-09-06