Mutagenetix > Incidental Mutations

Incidental Mutation 'R5399:Abcb5'

429898

Institutional Source

Beutler Lab

Gene Symbol

Abcb5

Ensembl Gene

ENSMUSG00000072791

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 5

Synonyms

9230106F14Rik

MMRRC Submission

042970-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.186) question?

Stock #

R5399 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118867824-118966421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118911499 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 646 (Y646F)

Ref Sequence

ENSEMBL: ENSMUSP00000046177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035515]

Predicted Effect

probably benign
Transcript: ENSMUST00000035515
AA Change: Y646F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: Y646F

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	49	338	1.9e-74	PFAM
AAA	414	606	2.1e-19	SMART
Pfam:ABC_membrane	693	967	7.3e-59	PFAM
Blast:AAA	969	1040	2e-11	BLAST
AAA	1043	1231	8.26e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100982

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	G	T	2: 152,440,868	L214F	probably damaging	Het
Abcb1b	T	C	5: 8,827,410	S657P	probably benign	Het
Agl	A	T	3: 116,781,628	L620Q	probably damaging	Het
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Arhgap23	A	G	11: 97,500,917	N1420S	probably damaging	Het
Arntl2	T	G	6: 146,822,661	D350E	probably damaging	Het
Barx2	A	G	9: 31,854,111		probably null	Het
Birc6	C	A	17: 74,604,578	S28R	possibly damaging	Het
Btbd19	G	A	4: 117,123,760	A104V	probably damaging	Het
Casp4	A	T	9: 5,324,928	K247*	probably null	Het
Clk4	T	C	11: 51,275,257	Y17H	probably damaging	Het
Cntnap1	A	G	11: 101,183,316	Q722R	probably benign	Het
Col6a6	A	G	9: 105,709,107	V1905A	possibly damaging	Het
Csmd1	C	A	8: 16,710,597	G174V	probably damaging	Het
Cul1	T	A	6: 47,485,084		probably null	Het
Cux1	T	C	5: 136,252,604	E568G	possibly damaging	Het
Dnaaf2	A	G	12: 69,196,742	I515T	probably damaging	Het
Fbn1	T	C	2: 125,332,333	I1868V	possibly damaging	Het
Fcgbp	G	T	7: 28,105,055	V1863L	probably benign	Het
G2e3	T	C	12: 51,357,194		probably null	Het
Gabrr2	T	C	4: 33,071,458		probably null	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Gbgt1	C	T	2: 28,503,218	P106L	probably damaging	Het
Gm13023	T	C	4: 143,795,032	F406S	probably benign	Het
Gm6657	A	C	12: 78,197,453	N60T	probably damaging	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Golga3	A	G	5: 110,205,024	E927G	probably damaging	Het
Hfm1	T	A	5: 106,917,562	I84F	possibly damaging	Het
Htt	G	T	5: 34,877,151	D1989Y	probably damaging	Het
Ihh	C	T	1: 74,946,277	A350T	probably benign	Het
Irx4	G	C	13: 73,265,539	A43P	probably benign	Het
Itk	A	G	11: 46,338,111	V414A	probably benign	Het
Itsn2	A	T	12: 4,653,535	I744L	probably benign	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Kif14	A	G	1: 136,503,324	D1153G	probably benign	Het
Morc3	A	G	16: 93,862,539		probably null	Het
Msc	A	T	1: 14,755,556	C65S	probably benign	Het
Mybpc1	A	G	10: 88,523,014	V343A	probably damaging	Het
Myo5c	T	C	9: 75,288,074	I1218T	possibly damaging	Het
Mypn	C	T	10: 63,120,186	V1163I	probably benign	Het
Obox3	A	T	7: 15,626,288	M152K	probably benign	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1204	T	A	2: 88,852,655	L235H	probably damaging	Het
Olfr1264	T	A	2: 90,021,923	T48S	probably benign	Het
Olfr328	A	G	11: 58,552,143	V32A	probably benign	Het
Pcdhb21	G	T	18: 37,515,719	V634L	probably benign	Het
Ppp1r9b	G	A	11: 94,992,148	A201T	probably benign	Het
Prss23	A	T	7: 89,509,966	D298E	probably benign	Het
Rab4b	A	T	7: 27,176,162	N31K	probably benign	Het
Ros1	A	G	10: 52,090,944		probably null	Het
Rragb	G	A	X: 153,140,554	G24E	probably damaging	Het
Rtl1	A	T	12: 109,590,302	L1701Q	probably damaging	Het
Sbno1	T	A	5: 124,392,741	N831Y	probably benign	Het
Selp	A	G	1: 164,126,586	K152E	possibly damaging	Het
Sema4b	A	G	7: 80,224,886	T675A	probably benign	Het
Slc36a3	T	C	11: 55,146,180	I100V	possibly damaging	Het
Slco1a4	T	A	6: 141,830,707	I196F	probably damaging	Het
Spata13	G	A	14: 60,747,541	S828N	probably benign	Het
Stard13	A	T	5: 151,047,801	Y643*	probably null	Het
Tll1	T	C	8: 64,085,488	H374R	probably damaging	Het
Trmt10a	T	A	3: 138,147,504	I42K	probably damaging	Het
Trmu	A	T	15: 85,896,408		probably null	Het
Trp53	T	A	11: 69,588,546	D183E	probably benign	Het
Ttc22	T	G	4: 106,636,757	F305V	probably damaging	Het
Unc13c	A	G	9: 73,749,688	F1077S	possibly damaging	Het
Utrn	T	A	10: 12,640,983	Q2289L	probably damaging	Het
Vmn1r65	C	A	7: 6,008,810	E142*	probably null	Het
Vmn2r63	A	T	7: 42,928,277	V279D	probably benign	Het
Zfp810	G	A	9: 22,278,829	T261I	possibly damaging	Het
Zkscan17	A	G	11: 59,502,918		probably null	Het

Other mutations in Abcb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Abcb5	APN	12	118890610	missense	probably benign	0.03
IGL00092:Abcb5	APN	12	118928695	missense	probably benign	0.09
IGL00503:Abcb5	APN	12	118907601	missense	probably benign	0.02
IGL00776:Abcb5	APN	12	118919854	missense	probably damaging	1.00
IGL01116:Abcb5	APN	12	118886176	missense	probably benign
IGL01302:Abcb5	APN	12	118918200	missense	probably damaging	1.00
IGL01403:Abcb5	APN	12	118872867	missense	probably damaging	1.00
IGL01453:Abcb5	APN	12	118867970	missense	probably damaging	1.00
IGL01541:Abcb5	APN	12	118911434	missense	probably benign	0.03
IGL01784:Abcb5	APN	12	118890664	missense	probably benign	0.14
IGL01967:Abcb5	APN	12	118867972	missense	probably damaging	1.00
IGL01987:Abcb5	APN	12	118927358	missense	probably damaging	1.00
IGL02104:Abcb5	APN	12	118940680	missense	probably damaging	1.00
IGL02161:Abcb5	APN	12	118874755	missense	probably benign
IGL02292:Abcb5	APN	12	118918197	missense	probably damaging	1.00
IGL02381:Abcb5	APN	12	118940678	missense	probably damaging	1.00
IGL02544:Abcb5	APN	12	118906268	splice site	probably benign
IGL02685:Abcb5	APN	12	118905947	missense	probably damaging	0.99
IGL02824:Abcb5	APN	12	118890685	missense	probably benign	0.05
IGL02876:Abcb5	APN	12	118919841	missense	probably damaging	1.00
IGL02929:Abcb5	APN	12	118944939	missense	probably damaging	0.99
IGL03030:Abcb5	APN	12	118940369	missense	possibly damaging	0.93
IGL03062:Abcb5	APN	12	118936087	missense	probably benign	0.43
IGL03200:Abcb5	APN	12	118965254	splice site	probably benign
IGL03407:Abcb5	APN	12	118940376	missense	probably benign	0.01
F5770:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
PIT4366001:Abcb5	UTSW	12	118936098	missense	probably damaging	1.00
PIT4434001:Abcb5	UTSW	12	118890687	missense	probably damaging	1.00
R0078:Abcb5	UTSW	12	118927394	missense	probably benign
R0219:Abcb5	UTSW	12	118886150	splice site	probably benign
R0312:Abcb5	UTSW	12	118872837	missense	probably damaging	1.00
R0347:Abcb5	UTSW	12	118965251	splice site	probably benign
R0359:Abcb5	UTSW	12	118940332	missense	probably damaging	1.00
R0433:Abcb5	UTSW	12	118877810	missense	probably benign	0.03
R0582:Abcb5	UTSW	12	118940412	missense	probably benign	0.40
R0815:Abcb5	UTSW	12	118901449	splice site	probably benign
R0900:Abcb5	UTSW	12	118940624	missense	probably damaging	1.00
R0942:Abcb5	UTSW	12	118906198	missense	possibly damaging	0.94
R0988:Abcb5	UTSW	12	118932575	missense	probably benign	0.36
R1125:Abcb5	UTSW	12	118911547	missense	possibly damaging	0.87
R1437:Abcb5	UTSW	12	118874762	missense	probably damaging	0.99
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1678:Abcb5	UTSW	12	118965329	start gained	probably benign
R1726:Abcb5	UTSW	12	118874801	splice site	probably null
R1726:Abcb5	UTSW	12	118907532	missense	possibly damaging	0.95
R1836:Abcb5	UTSW	12	118867961	missense	possibly damaging	0.93
R1934:Abcb5	UTSW	12	118907500	splice site	probably null
R1976:Abcb5	UTSW	12	118890682	missense	probably benign
R2005:Abcb5	UTSW	12	118877827	missense	probably benign	0.15
R2068:Abcb5	UTSW	12	118940568	nonsense	probably null
R2181:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R2191:Abcb5	UTSW	12	118867956	missense	probably damaging	1.00
R3690:Abcb5	UTSW	12	118872933	missense	probably damaging	1.00
R3746:Abcb5	UTSW	12	118874620	missense	probably damaging	0.99
R3825:Abcb5	UTSW	12	118901352	splice site	probably null
R3919:Abcb5	UTSW	12	118890618	missense	possibly damaging	0.67
R4049:Abcb5	UTSW	12	118868669	missense	probably damaging	0.99
R4409:Abcb5	UTSW	12	118872922	missense	probably damaging	0.98
R4606:Abcb5	UTSW	12	118932610	critical splice acceptor site	probably null
R4705:Abcb5	UTSW	12	118965305	missense	possibly damaging	0.95
R4954:Abcb5	UTSW	12	118911434	missense	probably benign	0.03
R4966:Abcb5	UTSW	12	118886891	intron	probably benign
R5169:Abcb5	UTSW	12	118877817	nonsense	probably null
R5327:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R5333:Abcb5	UTSW	12	118867942	missense	probably damaging	1.00
R5366:Abcb5	UTSW	12	118867930	missense	possibly damaging	0.93
R5373:Abcb5	UTSW	12	118887177	missense	probably damaging	1.00
R5416:Abcb5	UTSW	12	118907596	missense	probably damaging	1.00
R5447:Abcb5	UTSW	12	118927326	missense	probably damaging	1.00
R5474:Abcb5	UTSW	12	118940690	missense	probably null	1.00
R5566:Abcb5	UTSW	12	118935967	missense	probably damaging	0.99
R5685:Abcb5	UTSW	12	118932613	splice site	probably null
R5691:Abcb5	UTSW	12	118927235	missense	probably damaging	0.99
R5742:Abcb5	UTSW	12	118918257	missense	probably damaging	0.96
R5852:Abcb5	UTSW	12	118927404	missense	probably damaging	0.99
R5917:Abcb5	UTSW	12	118868781	nonsense	probably null
R5994:Abcb5	UTSW	12	118965260	critical splice donor site	probably null
R6295:Abcb5	UTSW	12	118874644	missense	probably damaging	0.99
R6455:Abcb5	UTSW	12	118890549	critical splice donor site	probably null
R6609:Abcb5	UTSW	12	118928762	missense	probably damaging	1.00
R6753:Abcb5	UTSW	12	118944906	missense	possibly damaging	0.86
R6818:Abcb5	UTSW	12	118901354	splice site	probably null
R6870:Abcb5	UTSW	12	118965265	missense	possibly damaging	0.87
R6944:Abcb5	UTSW	12	118911530	missense	probably benign	0.06
R6957:Abcb5	UTSW	12	118907535	missense	probably damaging	1.00
R6984:Abcb5	UTSW	12	118927277	missense	possibly damaging	0.47
R7021:Abcb5	UTSW	12	118931925	missense	probably benign	0.00
R7061:Abcb5	UTSW	12	118877774	missense	probably damaging	1.00
R7175:Abcb5	UTSW	12	118867876	missense	probably benign	0.00
R7239:Abcb5	UTSW	12	118928725	missense	probably benign	0.19
R7267:Abcb5	UTSW	12	118952470	missense	probably damaging	1.00
R7303:Abcb5	UTSW	12	118911560	missense	probably damaging	0.96
R7396:Abcb5	UTSW	12	118867874	missense	probably damaging	1.00
R7605:Abcb5	UTSW	12	118918164	missense	probably damaging	1.00
V7580:Abcb5	UTSW	12	118886179	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TGAGAGCAAACGCTTTGTGA -3'
(R):5'- ACATCCTCACCTTCCAACTG -3'

Sequencing Primer
(F):5'- CAAACGCTTTGTGAACTTAGTGGC -3'
(R):5'- ACAAGCACTTTGGCAGCTG -3'

Posted On

2016-09-06