Incidental Mutation 'R5399:Trmu'
ID429902
Institutional Source Beutler Lab
Gene Symbol Trmu
Ensembl Gene ENSMUSG00000022386
Gene NametRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Synonyms1600025P05Rik, Trmt1, 1110005N20Rik
MMRRC Submission 042970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5399 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85879312-85897394 bp(+) (GRCm38)
Type of Mutationunclassified (2522 bp from exon)
DNA Base Change (assembly) A to T at 85896408 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172] [ENSMUST00000023019] [ENSMUST00000162491]
Predicted Effect probably null
Transcript: ENSMUST00000016172
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000023019
AA Change: N308Y

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023019
Gene: ENSMUSG00000022386
AA Change: N308Y

DomainStartEndE-ValueType
Pfam:NAD_synthase 1 133 7.7e-7 PFAM
Pfam:ThiI 3 79 7.7e-8 PFAM
Pfam:tRNA_Me_trans 5 383 3.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162010
Predicted Effect probably benign
Transcript: ENSMUST00000162339
SMART Domains Protein: ENSMUSP00000125266
Gene: ENSMUSG00000022386

DomainStartEndE-ValueType
Pfam:tRNA_Me_trans 1 46 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162491
SMART Domains Protein: ENSMUSP00000125704
Gene: ENSMUSG00000022386

DomainStartEndE-ValueType
Pfam:NAD_synthase 1 88 1.1e-8 PFAM
Pfam:Asn_synthase 1 90 3e-7 PFAM
Pfam:ThiI 3 84 1.6e-10 PFAM
Pfam:tRNA_Me_trans 5 88 2.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162601
Predicted Effect probably null
Transcript: ENSMUST00000226204
Predicted Effect probably null
Transcript: ENSMUST00000226840
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a mitochondrial tRNA-modifying enzyme. The encoded protein catalyzes the 2-thiolation of uridine on the wobble positions of tRNA(Lys), tRNA(Glu), and tRNA(Gln), resulting in the formation of 5-taurinomethyl-2-thiouridine moieties. Mutations in this gene may cause transient infantile liver failure. Polymorphisms in this gene may also influence the severity of deafness caused by mitochondrial 12S ribosomal RNA mutations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous KO is embryonic lethal. Homozygous conditional KO in the liver affects mitochondrial function owing to impaired mt-tRNA modifications. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G T 2: 152,440,868 L214F probably damaging Het
Abcb1b T C 5: 8,827,410 S657P probably benign Het
Abcb5 T A 12: 118,911,499 Y646F probably benign Het
Agl A T 3: 116,781,628 L620Q probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Arhgap23 A G 11: 97,500,917 N1420S probably damaging Het
Arntl2 T G 6: 146,822,661 D350E probably damaging Het
Barx2 A G 9: 31,854,111 probably null Het
Birc6 C A 17: 74,604,578 S28R possibly damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Casp4 A T 9: 5,324,928 K247* probably null Het
Clk4 T C 11: 51,275,257 Y17H probably damaging Het
Cntnap1 A G 11: 101,183,316 Q722R probably benign Het
Col6a6 A G 9: 105,709,107 V1905A possibly damaging Het
Csmd1 C A 8: 16,710,597 G174V probably damaging Het
Cul1 T A 6: 47,485,084 probably null Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Dnaaf2 A G 12: 69,196,742 I515T probably damaging Het
Fbn1 T C 2: 125,332,333 I1868V possibly damaging Het
Fcgbp G T 7: 28,105,055 V1863L probably benign Het
G2e3 T C 12: 51,357,194 probably null Het
Gabrr2 T C 4: 33,071,458 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gbgt1 C T 2: 28,503,218 P106L probably damaging Het
Gm13023 T C 4: 143,795,032 F406S probably benign Het
Gm6657 A C 12: 78,197,453 N60T probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,205,024 E927G probably damaging Het
Hfm1 T A 5: 106,917,562 I84F possibly damaging Het
Htt G T 5: 34,877,151 D1989Y probably damaging Het
Ihh C T 1: 74,946,277 A350T probably benign Het
Irx4 G C 13: 73,265,539 A43P probably benign Het
Itk A G 11: 46,338,111 V414A probably benign Het
Itsn2 A T 12: 4,653,535 I744L probably benign Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif14 A G 1: 136,503,324 D1153G probably benign Het
Morc3 A G 16: 93,862,539 probably null Het
Msc A T 1: 14,755,556 C65S probably benign Het
Mybpc1 A G 10: 88,523,014 V343A probably damaging Het
Myo5c T C 9: 75,288,074 I1218T possibly damaging Het
Mypn C T 10: 63,120,186 V1163I probably benign Het
Obox3 A T 7: 15,626,288 M152K probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1204 T A 2: 88,852,655 L235H probably damaging Het
Olfr1264 T A 2: 90,021,923 T48S probably benign Het
Olfr328 A G 11: 58,552,143 V32A probably benign Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prss23 A T 7: 89,509,966 D298E probably benign Het
Rab4b A T 7: 27,176,162 N31K probably benign Het
Ros1 A G 10: 52,090,944 probably null Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Rtl1 A T 12: 109,590,302 L1701Q probably damaging Het
Sbno1 T A 5: 124,392,741 N831Y probably benign Het
Selp A G 1: 164,126,586 K152E possibly damaging Het
Sema4b A G 7: 80,224,886 T675A probably benign Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Slco1a4 T A 6: 141,830,707 I196F probably damaging Het
Spata13 G A 14: 60,747,541 S828N probably benign Het
Stard13 A T 5: 151,047,801 Y643* probably null Het
Tll1 T C 8: 64,085,488 H374R probably damaging Het
Trmt10a T A 3: 138,147,504 I42K probably damaging Het
Trp53 T A 11: 69,588,546 D183E probably benign Het
Ttc22 T G 4: 106,636,757 F305V probably damaging Het
Unc13c A G 9: 73,749,688 F1077S possibly damaging Het
Utrn T A 10: 12,640,983 Q2289L probably damaging Het
Vmn1r65 C A 7: 6,008,810 E142* probably null Het
Vmn2r63 A T 7: 42,928,277 V279D probably benign Het
Zfp810 G A 9: 22,278,829 T261I possibly damaging Het
Zkscan17 A G 11: 59,502,918 probably null Het
Other mutations in Trmu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Trmu APN 15 85882831 missense probably benign 0.00
IGL02873:Trmu APN 15 85896832 splice site probably null
IGL03375:Trmu APN 15 85894937 missense possibly damaging 0.65
R0592:Trmu UTSW 15 85896826 unclassified probably benign
R0781:Trmu UTSW 15 85879403 nonsense probably null
R1120:Trmu UTSW 15 85890285 missense possibly damaging 0.75
R1165:Trmu UTSW 15 85892674 missense probably damaging 0.99
R1443:Trmu UTSW 15 85897101 unclassified probably null
R1503:Trmu UTSW 15 85895019 missense possibly damaging 0.88
R4626:Trmu UTSW 15 85894985 missense possibly damaging 0.96
R4790:Trmu UTSW 15 85882805 missense probably damaging 1.00
R5134:Trmu UTSW 15 85896355 splice site probably null
R5639:Trmu UTSW 15 85882698 missense probably damaging 1.00
R6831:Trmu UTSW 15 85895006 missense probably benign
RF007:Trmu UTSW 15 85892569 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAGGGTGAACTGAGCCTTAAG -3'
(R):5'- AAGGGAATACTGCACGTGTAC -3'

Sequencing Primer
(F):5'- GCCTTAAGCTGATGAATGGATTTCTC -3'
(R):5'- GGAATACTGCACGTGTACAGTCTAC -3'
Posted On2016-09-06