Incidental Mutation 'R5399:Rragb'
ID429907
Institutional Source Beutler Lab
Gene Symbol Rragb
Ensembl Gene ENSMUSG00000041658
Gene NameRas-related GTP binding B
Synonyms
MMRRC Submission 042970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5399 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location153139981-153171943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 153140554 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 24 (G24E)
Ref Sequence ENSEMBL: ENSMUSP00000134162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039720] [ENSMUST00000144175]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039720
AA Change: G24E

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039013
Gene: ENSMUSG00000041658
AA Change: G24E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Arf 32 241 1.2e-6 PFAM
Pfam:Ras 42 238 3.8e-6 PFAM
Pfam:Gtr1_RagA 42 296 1.8e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144175
AA Change: G24E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134162
Gene: ENSMUSG00000041658
AA Change: G24E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Gtr1_RagA 42 116 7.9e-39 PFAM
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ras-homologous GTPases constitute a large family of signal transducers that alternate between an activated, GTP-binding state and an inactivated, GDP-binding state. These proteins represent cellular switches that are operated by GTP-exchange factors and factors that stimulate their intrinsic GTPase activity. All GTPases of the Ras superfamily have in common the presence of six conserved motifs involved in GTP/GDP binding, three of which are phosphate-/magnesium-binding sites (PM1-PM3) and three of which are guanine nucleotide-binding sites (G1-G3). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G T 2: 152,440,868 L214F probably damaging Het
Abcb1b T C 5: 8,827,410 S657P probably benign Het
Abcb5 T A 12: 118,911,499 Y646F probably benign Het
Agl A T 3: 116,781,628 L620Q probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Arhgap23 A G 11: 97,500,917 N1420S probably damaging Het
Arntl2 T G 6: 146,822,661 D350E probably damaging Het
Barx2 A G 9: 31,854,111 probably null Het
Birc6 C A 17: 74,604,578 S28R possibly damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Casp4 A T 9: 5,324,928 K247* probably null Het
Clk4 T C 11: 51,275,257 Y17H probably damaging Het
Cntnap1 A G 11: 101,183,316 Q722R probably benign Het
Col6a6 A G 9: 105,709,107 V1905A possibly damaging Het
Csmd1 C A 8: 16,710,597 G174V probably damaging Het
Cul1 T A 6: 47,485,084 probably null Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Dnaaf2 A G 12: 69,196,742 I515T probably damaging Het
Fbn1 T C 2: 125,332,333 I1868V possibly damaging Het
Fcgbp G T 7: 28,105,055 V1863L probably benign Het
G2e3 T C 12: 51,357,194 probably null Het
Gabrr2 T C 4: 33,071,458 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gbgt1 C T 2: 28,503,218 P106L probably damaging Het
Gm13023 T C 4: 143,795,032 F406S probably benign Het
Gm6657 A C 12: 78,197,453 N60T probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,205,024 E927G probably damaging Het
Hfm1 T A 5: 106,917,562 I84F possibly damaging Het
Htt G T 5: 34,877,151 D1989Y probably damaging Het
Ihh C T 1: 74,946,277 A350T probably benign Het
Irx4 G C 13: 73,265,539 A43P probably benign Het
Itk A G 11: 46,338,111 V414A probably benign Het
Itsn2 A T 12: 4,653,535 I744L probably benign Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif14 A G 1: 136,503,324 D1153G probably benign Het
Morc3 A G 16: 93,862,539 probably null Het
Msc A T 1: 14,755,556 C65S probably benign Het
Mybpc1 A G 10: 88,523,014 V343A probably damaging Het
Myo5c T C 9: 75,288,074 I1218T possibly damaging Het
Mypn C T 10: 63,120,186 V1163I probably benign Het
Obox3 A T 7: 15,626,288 M152K probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1204 T A 2: 88,852,655 L235H probably damaging Het
Olfr1264 T A 2: 90,021,923 T48S probably benign Het
Olfr328 A G 11: 58,552,143 V32A probably benign Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prss23 A T 7: 89,509,966 D298E probably benign Het
Rab4b A T 7: 27,176,162 N31K probably benign Het
Ros1 A G 10: 52,090,944 probably null Het
Rtl1 A T 12: 109,590,302 L1701Q probably damaging Het
Sbno1 T A 5: 124,392,741 N831Y probably benign Het
Selp A G 1: 164,126,586 K152E possibly damaging Het
Sema4b A G 7: 80,224,886 T675A probably benign Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Slco1a4 T A 6: 141,830,707 I196F probably damaging Het
Spata13 G A 14: 60,747,541 S828N probably benign Het
Stard13 A T 5: 151,047,801 Y643* probably null Het
Tll1 T C 8: 64,085,488 H374R probably damaging Het
Trmt10a T A 3: 138,147,504 I42K probably damaging Het
Trmu A T 15: 85,896,408 probably null Het
Trp53 T A 11: 69,588,546 D183E probably benign Het
Ttc22 T G 4: 106,636,757 F305V probably damaging Het
Unc13c A G 9: 73,749,688 F1077S possibly damaging Het
Utrn T A 10: 12,640,983 Q2289L probably damaging Het
Vmn1r65 C A 7: 6,008,810 E142* probably null Het
Vmn2r63 A T 7: 42,928,277 V279D probably benign Het
Zfp810 G A 9: 22,278,829 T261I possibly damaging Het
Zkscan17 A G 11: 59,502,918 probably null Het
Other mutations in Rragb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rragb APN X 153171298 missense possibly damaging 0.75
IGL03268:Rragb APN X 153140497 missense unknown
R5398:Rragb UTSW X 153140554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCGGGTCGGTAAAGGTAAC -3'
(R):5'- TTCCGTCATCAAGGGCATG -3'

Sequencing Primer
(F):5'- TGTGGGAAAAGCGGCCC -3'
(R):5'- TCCGTCATCAAGGGCATGATATC -3'
Posted On2016-09-06