Mutagenetix > Incidental Mutation

Incidental Mutation 'R5400:Kansl3'

429908

Institutional Source

Beutler Lab

Gene Symbol

Kansl3

Ensembl Gene

ENSMUSG00000010453

Gene Name

KAT8 regulatory NSL complex subunit 3

Synonyms

MMRRC Submission

042971-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R5400 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36335730-36369181 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36358149 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 86 (V86A)

Ref Sequence

ENSEMBL: ENSMUSP00000140547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010597] [ENSMUST00000185621] [ENSMUST00000185912] [ENSMUST00000186470] [ENSMUST00000188528] [ENSMUST00000188961]

AlphaFold

A2RSY1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000010597
AA Change: V185A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000010597
Gene: ENSMUSG00000010453
AA Change: V185A

Domain	Start	End	E-Value	Type
low complexity region	113	125	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
low complexity region	271	285	N/A	INTRINSIC
Pfam:Abhydrolase_5	288	436	2e-9	PFAM
low complexity region	523	555	N/A	INTRINSIC
low complexity region	669	697	N/A	INTRINSIC
low complexity region	718	732	N/A	INTRINSIC
low complexity region	735	751	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185621

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185912
AA Change: V86A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140547
Gene: ENSMUSG00000010453
AA Change: V86A

Domain	Start	End	E-Value	Type
low complexity region	14	26	N/A	INTRINSIC
low complexity region	139	150	N/A	INTRINSIC
low complexity region	172	186	N/A	INTRINSIC
Pfam:Abhydrolase_5	189	337	9.3e-8	PFAM
low complexity region	424	456	N/A	INTRINSIC
low complexity region	570	598	N/A	INTRINSIC
low complexity region	619	633	N/A	INTRINSIC
low complexity region	636	652	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186470
AA Change: V185A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000140597
Gene: ENSMUSG00000010453
AA Change: V185A

Domain	Start	End	E-Value	Type
low complexity region	113	125	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
low complexity region	271	285	N/A	INTRINSIC
Pfam:Abhydrolase_5	288	436	2.2e-9	PFAM
low complexity region	523	555	N/A	INTRINSIC
low complexity region	578	586	N/A	INTRINSIC
low complexity region	695	723	N/A	INTRINSIC
low complexity region	744	758	N/A	INTRINSIC
low complexity region	761	777	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188528

Predicted Effect

probably benign
Transcript: ENSMUST00000188961

Meta Mutation Damage Score

0.1040

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

98% (64/65)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	T	5: 9,479,247	N1027Y	probably damaging	Het
Accsl	T	C	2: 93,859,422	D380G	probably damaging	Het
Afm	T	C	5: 90,551,398	L567P	possibly damaging	Het
AI481877	A	G	4: 59,082,432	S399P	possibly damaging	Het
Anks1b	A	T	10: 90,512,824	I785L	probably damaging	Het
Arpc5l	G	A	2: 39,013,735	G79S	probably benign	Het
Arvcf	G	T	16: 18,399,070	R440L	probably benign	Het
Atm	T	C	9: 53,503,018	D924G	probably damaging	Het
Atp8b1	A	T	18: 64,545,989		probably null	Het
Cd19	C	T	7: 126,414,452	G55D	probably benign	Het
Cd34	A	G	1: 194,938,958		probably benign	Het
Cd69	T	A	6: 129,269,991	M88L	probably benign	Het
Ces2h	A	G	8: 105,018,425	E397G	probably benign	Het
Ddx60	T	C	8: 62,010,002	F1306L	possibly damaging	Het
Dennd5b	T	C	6: 149,000,016	E1124G	probably damaging	Het
Dio1	A	T	4: 107,306,988	M44K	probably damaging	Het
En1	A	G	1: 120,603,595	D188G	probably damaging	Het
Epha10	C	T	4: 124,914,121		probably benign	Het
Fam120b	A	T	17: 15,403,126	L455F	possibly damaging	Het
Flt4	AC	ACC	11: 49,651,034		probably null	Het
Gm38394	G	A	1: 133,658,141	T486I	probably damaging	Het
Incenp	A	G	19: 9,877,675		probably null	Het
Klhl7	C	G	5: 24,126,920	F73L	probably damaging	Het
Med28	T	A	5: 45,525,199	V69D	probably damaging	Het
Mknk1	C	A	4: 115,864,552	L98M	probably damaging	Het
Mknk1	T	A	4: 115,864,553	L98Q	probably damaging	Het
Myo3b	T	A	2: 70,105,380	C97S	probably damaging	Het
Neto1	A	G	18: 86,395,908	H9R	possibly damaging	Het
Olfr1230	T	C	2: 89,296,913	D119G	probably damaging	Het
Olfr317	T	C	11: 58,732,320	T282A	possibly damaging	Het
Olfr354	A	T	2: 36,907,821	I292F	probably damaging	Het
Olfr78	G	A	7: 102,742,430	T191I	probably benign	Het
Omd	A	T	13: 49,592,227	E371V	probably benign	Het
Osbpl9	G	T	4: 109,062,300	Y733*	probably null	Het
Pcdh12	A	T	18: 38,268,898	S91R	probably damaging	Het
Pxk	C	A	14: 8,136,911	P144Q	probably benign	Het
Qser1	A	G	2: 104,789,874	S198P	probably damaging	Het
Recql	T	G	6: 142,362,347		probably benign	Het
Reln	T	C	5: 21,979,714	D1601G	probably damaging	Het
Scn10a	T	C	9: 119,609,034	D1922G	probably damaging	Het
Scn11a	T	A	9: 119,769,908	R1185S	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc13a4	A	T	6: 35,301,842	C37*	probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc9a9	T	A	9: 94,712,901	F155I	probably damaging	Het
Spef2	T	A	15: 9,614,281	K1193M	probably damaging	Het
Swt1	T	C	1: 151,412,834	T80A	probably benign	Het
Tmc1	A	G	19: 20,804,602	I584T	probably damaging	Het
Tsc22d1	C	A	14: 76,417,054	F324L	probably benign	Het
Usp19	T	C	9: 108,500,193	V1236A	probably damaging	Het
Vmn2r63	T	C	7: 42,928,211	N301S	probably benign	Het
Wrn	C	T	8: 33,294,917	V476I	probably benign	Het
Zbtb25	C	A	12: 76,349,702	E249*	probably null	Het
Zfp54	C	A	17: 21,433,700	T152K	probably benign	Het

Other mutations in Kansl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02220:Kansl3	APN	1	36367989	start gained	probably benign
IGL02277:Kansl3	APN	1	36348947	missense	possibly damaging	0.85
IGL02423:Kansl3	APN	1	36351969	missense	probably damaging	1.00
R0147:Kansl3	UTSW	1	36353816	missense	probably damaging	1.00
R0148:Kansl3	UTSW	1	36353816	missense	probably damaging	1.00
R0255:Kansl3	UTSW	1	36344969	missense	probably benign	0.01
R0279:Kansl3	UTSW	1	36351969	missense	probably damaging	0.99
R0349:Kansl3	UTSW	1	36351783	missense	probably damaging	1.00
R1452:Kansl3	UTSW	1	36354793	splice site	probably benign
R1599:Kansl3	UTSW	1	36367870	missense	probably damaging	1.00
R1842:Kansl3	UTSW	1	36351744	missense	probably damaging	1.00
R2310:Kansl3	UTSW	1	36343364	missense	probably damaging	1.00
R4093:Kansl3	UTSW	1	36344954	missense	probably damaging	1.00
R4961:Kansl3	UTSW	1	36348683	critical splice acceptor site	probably null
R5339:Kansl3	UTSW	1	36367721	intron	probably benign
R5564:Kansl3	UTSW	1	36345964	missense	possibly damaging	0.55
R5661:Kansl3	UTSW	1	36348957	missense	possibly damaging	0.55
R5965:Kansl3	UTSW	1	36345520	splice site	probably null
R6185:Kansl3	UTSW	1	36346018	missense	probably damaging	0.96
R6261:Kansl3	UTSW	1	36365605	missense	probably benign	0.01
R6706:Kansl3	UTSW	1	36344914	critical splice donor site	probably null
R7055:Kansl3	UTSW	1	36365620	missense	possibly damaging	0.86
R7134:Kansl3	UTSW	1	36351767	missense	possibly damaging	0.52
R7362:Kansl3	UTSW	1	36344127	missense	possibly damaging	0.82
R7461:Kansl3	UTSW	1	36343795	missense	probably damaging	1.00
R7571:Kansl3	UTSW	1	36365587	missense	possibly damaging	0.55
R7613:Kansl3	UTSW	1	36343795	missense	probably damaging	1.00
R7775:Kansl3	UTSW	1	36348677	missense	probably damaging	0.99
R7778:Kansl3	UTSW	1	36348677	missense	probably damaging	0.99
R8345:Kansl3	UTSW	1	36348816	critical splice donor site	probably null
R9017:Kansl3	UTSW	1	36354780	missense	probably benign	0.02
R9286:Kansl3	UTSW	1	36348639	missense	probably benign	0.01
R9287:Kansl3	UTSW	1	36349416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGTGCAAACCCTCTGAACTC -3'
(R):5'- CACGATTGGCCAATGAAGGG -3'

Sequencing Primer
(F):5'- TCACAGCAAACCCTGGCTG -3'
(R):5'- GGAAGTCTGTCTATAGTTGACTCTC -3'

Posted On

2016-09-06