Incidental Mutation 'R5400:En1'
ID429909
Institutional Source Beutler Lab
Gene Symbol En1
Ensembl Gene ENSMUSG00000058665
Gene Nameengrailed 1
SynonymsMo-en.1, En-1, engrailed-1
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5400 (G1)
Quality Score149
Status Validated
Chromosome1
Chromosomal Location120602418-120607992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120603595 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 188 (D188G)
Ref Sequence ENSEMBL: ENSMUSP00000078659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079721]
Predicted Effect probably damaging
Transcript: ENSMUST00000079721
AA Change: D188G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078659
Gene: ENSMUSG00000058665
AA Change: D188G

DomainStartEndE-ValueType
low complexity region 13 104 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
low complexity region 197 250 N/A INTRINSIC
HOX 312 374 1.11e-24 SMART
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant homozygotes usually die within 24 hours of birth. Mutants exhibit nervous system defects, including a lack of most of the colliculi, cerebellum, and the third and fourth cranial nerves in some lines. Skeletal anomalies have also been described. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in En1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:En1 APN 1 120606938 missense unknown
R1728:En1 UTSW 1 120603621 missense unknown
R1730:En1 UTSW 1 120603621 missense unknown
R1739:En1 UTSW 1 120603621 missense unknown
R1783:En1 UTSW 1 120603621 missense unknown
R1785:En1 UTSW 1 120603621 missense unknown
R1881:En1 UTSW 1 120603175 missense unknown
R1971:En1 UTSW 1 120607013 missense unknown
R2007:En1 UTSW 1 120603404 missense probably benign 0.33
R2279:En1 UTSW 1 120607187 makesense probably null
R4290:En1 UTSW 1 120603757 missense unknown
R4379:En1 UTSW 1 120603355 missense possibly damaging 0.53
R4709:En1 UTSW 1 120607143 missense unknown
R6257:En1 UTSW 1 120603907 missense unknown
R7024:En1 UTSW 1 120603322 missense unknown
R7359:En1 UTSW 1 120607088 missense unknown
R8807:En1 UTSW 1 120603361 missense possibly damaging 0.53
Z1177:En1 UTSW 1 120603453 missense probably benign 0.09
Z1177:En1 UTSW 1 120603663 missense unknown
Z1177:En1 UTSW 1 120607005 missense unknown
Predicted Primers PCR Primer
(F):5'- ACATCCTAAGGCCCGATTTCG -3'
(R):5'- CATGAGTAGGATCGCAGGGTTG -3'

Sequencing Primer
(F):5'- CGATTTCGGTTGCAAAAAGGAAC -3'
(R):5'- GTTCCGGGAACTTGGCG -3'
Posted On2016-09-06