Incidental Mutation 'R5400:Gm38394'
ID429910
Institutional Source Beutler Lab
Gene Symbol Gm38394
Ensembl Gene ENSMUSG00000094410
Gene Namepredicted gene, 38394
Synonyms
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location133619940-133661318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 133658141 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 486 (T486I)
Ref Sequence ENSEMBL: ENSMUSP00000140892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027736] [ENSMUST00000179598] [ENSMUST00000186476] [ENSMUST00000190574] [ENSMUST00000191896] [ENSMUST00000193504] [ENSMUST00000194668] [ENSMUST00000195424] [ENSMUST00000195067]
Predicted Effect probably benign
Transcript: ENSMUST00000027736
SMART Domains Protein: ENSMUSP00000027736
Gene: ENSMUSG00000116275

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179598
AA Change: T486I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136026
Gene: ENSMUSG00000094410
AA Change: T486I

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 9.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186476
AA Change: T486I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139417
Gene: ENSMUSG00000094410
AA Change: T486I

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190574
AA Change: T486I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140892
Gene: ENSMUSG00000102049
AA Change: T486I

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191705
Predicted Effect probably benign
Transcript: ENSMUST00000191896
SMART Domains Protein: ENSMUSP00000141255
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192775
Predicted Effect probably benign
Transcript: ENSMUST00000193504
SMART Domains Protein: ENSMUSP00000141895
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
Blast:ZnF_C3H1 60 84 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194668
SMART Domains Protein: ENSMUSP00000141727
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195424
SMART Domains Protein: ENSMUSP00000142066
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
low complexity region 161 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195067
Meta Mutation Damage Score 0.3453 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Gm38394
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0385:Gm38394 UTSW 1 133656784 missense probably damaging 0.99
R0417:Gm38394 UTSW 1 133658538 missense probably benign
R0526:Gm38394 UTSW 1 133658734 missense probably damaging 0.99
R0576:Gm38394 UTSW 1 133657838 missense probably benign 0.37
R1164:Gm38394 UTSW 1 133659203 missense probably damaging 1.00
R1187:Gm38394 UTSW 1 133659203 missense probably damaging 1.00
R1415:Gm38394 UTSW 1 133657818 missense possibly damaging 0.80
R1997:Gm38394 UTSW 1 133656713 missense probably damaging 1.00
R2186:Gm38394 UTSW 1 133658079 missense probably damaging 1.00
R2875:Gm38394 UTSW 1 133656860 missense probably damaging 1.00
R2876:Gm38394 UTSW 1 133656860 missense probably damaging 1.00
R2975:Gm38394 UTSW 1 133658237 missense probably damaging 0.99
R4573:Gm38394 UTSW 1 133659389 missense probably benign 0.00
R4631:Gm38394 UTSW 1 133658744 missense probably damaging 1.00
R4671:Gm38394 UTSW 1 133657040 missense probably benign
R4976:Gm38394 UTSW 1 133658094 missense probably benign 0.27
R5048:Gm38394 UTSW 1 133658724 missense probably damaging 0.99
R5318:Gm38394 UTSW 1 133658115 missense possibly damaging 0.86
R5427:Gm38394 UTSW 1 133657595 missense possibly damaging 0.83
R6530:Gm38394 UTSW 1 133659201 missense probably damaging 1.00
R7511:Gm38394 UTSW 1 133659243 missense probably benign 0.30
R8215:Gm38394 UTSW 1 133658792 missense probably damaging 1.00
R8529:Gm38394 UTSW 1 133656968 missense probably benign 0.00
R8685:Gm38394 UTSW 1 133657016 nonsense probably null
Z1177:Gm38394 UTSW 1 133659116 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTGAGTCTCTGCAGGGAA -3'
(R):5'- TACAACTATTTCTCAACCCCAGC -3'

Sequencing Primer
(F):5'- GGGTAAAGCCACCACCTTTGATTG -3'
(R):5'- CCTTTCAAAGGTTTCTACAGATTGTC -3'
Posted On2016-09-06