Incidental Mutation 'R5400:Swt1'
ID429911
Institutional Source Beutler Lab
Gene Symbol Swt1
Ensembl Gene ENSMUSG00000052748
Gene NameSWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location151367699-151428455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151412834 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 80 (T80A)
Ref Sequence ENSEMBL: ENSMUSP00000107514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064771] [ENSMUST00000111883]
Predicted Effect probably benign
Transcript: ENSMUST00000064771
AA Change: T80A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000067516
Gene: ENSMUSG00000052748
AA Change: T80A

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
low complexity region 783 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111883
AA Change: T80A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107514
Gene: ENSMUSG00000052748
AA Change: T80A

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129939
SMART Domains Protein: ENSMUSP00000120483
Gene: ENSMUSG00000052748

DomainStartEndE-ValueType
PINc 146 245 6.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138095
Meta Mutation Damage Score 0.0803 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Swt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Swt1 APN 1 151411139 missense probably damaging 0.99
IGL01622:Swt1 APN 1 151411009 missense probably benign 0.01
IGL01623:Swt1 APN 1 151411009 missense probably benign 0.01
IGL01672:Swt1 APN 1 151394608 critical splice donor site probably null
IGL01693:Swt1 APN 1 151422104 missense probably benign 0.02
IGL02203:Swt1 APN 1 151370626 missense probably benign 0.01
IGL03223:Swt1 APN 1 151379419 missense possibly damaging 0.80
R0124:Swt1 UTSW 1 151391529 missense probably damaging 1.00
R0496:Swt1 UTSW 1 151411270 missense probably benign
R1037:Swt1 UTSW 1 151370569 splice site probably benign
R1171:Swt1 UTSW 1 151405521 missense probably damaging 1.00
R1270:Swt1 UTSW 1 151384391 missense probably benign 0.00
R1883:Swt1 UTSW 1 151423533 nonsense probably null
R2051:Swt1 UTSW 1 151372330 missense probably damaging 1.00
R2110:Swt1 UTSW 1 151403885 missense probably damaging 0.97
R2185:Swt1 UTSW 1 151384468 missense probably damaging 1.00
R3688:Swt1 UTSW 1 151391489 missense probably damaging 0.99
R3785:Swt1 UTSW 1 151379404 missense probably benign 0.03
R4074:Swt1 UTSW 1 151394769 missense probably benign
R4157:Swt1 UTSW 1 151403044 missense probably damaging 1.00
R4660:Swt1 UTSW 1 151407597 missense probably benign 0.18
R4761:Swt1 UTSW 1 151401102 missense probably benign 0.43
R4972:Swt1 UTSW 1 151423542 missense probably benign 0.22
R5141:Swt1 UTSW 1 151411394 missense probably benign 0.04
R5227:Swt1 UTSW 1 151402976 nonsense probably null
R5580:Swt1 UTSW 1 151384455 missense probably benign 0.00
R5912:Swt1 UTSW 1 151411409 missense probably damaging 1.00
R5945:Swt1 UTSW 1 151411170 missense probably benign 0.01
R5973:Swt1 UTSW 1 151402949 splice site probably null
R5979:Swt1 UTSW 1 151407588 missense possibly damaging 0.94
R6242:Swt1 UTSW 1 151407614 missense probably benign 0.41
R6283:Swt1 UTSW 1 151384333 missense possibly damaging 0.78
R6951:Swt1 UTSW 1 151397268 missense possibly damaging 0.88
R7009:Swt1 UTSW 1 151370630 missense possibly damaging 0.94
R7165:Swt1 UTSW 1 151388677 missense probably damaging 1.00
R7214:Swt1 UTSW 1 151394613 missense possibly damaging 0.63
R7403:Swt1 UTSW 1 151388693 missense probably benign 0.01
R7439:Swt1 UTSW 1 151411064 missense probably benign 0.04
R7441:Swt1 UTSW 1 151411064 missense probably benign 0.04
R7571:Swt1 UTSW 1 151394719 missense probably benign 0.00
R8028:Swt1 UTSW 1 151384497 missense probably benign 0.26
R8225:Swt1 UTSW 1 151422108 missense possibly damaging 0.96
X0062:Swt1 UTSW 1 151411439 missense probably benign 0.43
Z1176:Swt1 UTSW 1 151388685 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTGACATAGCCCAGTGC -3'
(R):5'- CTATGAAGGCTCTATGCTCCAG -3'

Sequencing Primer
(F):5'- GCCCAGTGCTTGCCTAG -3'
(R):5'- AAGGCTCTATGCTCCAGTGTGG -3'
Posted On2016-09-06