Incidental Mutation 'R5400:Swt1'
ID 429911
Institutional Source Beutler Lab
Gene Symbol Swt1
Ensembl Gene ENSMUSG00000052748
Gene Name SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms 1200016B10Rik
MMRRC Submission 042971-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.180) question?
Stock # R5400 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 151243450-151304206 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 151288585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 80 (T80A)
Ref Sequence ENSEMBL: ENSMUSP00000107514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064771] [ENSMUST00000111883]
AlphaFold Q9DBQ9
Predicted Effect probably benign
Transcript: ENSMUST00000064771
AA Change: T80A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000067516
Gene: ENSMUSG00000052748
AA Change: T80A

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
low complexity region 783 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111883
AA Change: T80A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107514
Gene: ENSMUSG00000052748
AA Change: T80A

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129939
SMART Domains Protein: ENSMUSP00000120483
Gene: ENSMUSG00000052748

DomainStartEndE-ValueType
PINc 146 245 6.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138095
Meta Mutation Damage Score 0.0803 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl T C 2: 93,689,767 (GRCm39) D380G probably damaging Het
Afm T C 5: 90,699,257 (GRCm39) L567P possibly damaging Het
Anks1b A T 10: 90,348,686 (GRCm39) I785L probably damaging Het
Arpc5l G A 2: 38,903,747 (GRCm39) G79S probably benign Het
Arvcf G T 16: 18,217,820 (GRCm39) R440L probably benign Het
Atm T C 9: 53,414,318 (GRCm39) D924G probably damaging Het
Atp8b1 A T 18: 64,679,060 (GRCm39) probably null Het
Cd19 C T 7: 126,013,624 (GRCm39) G55D probably benign Het
Cd34 A G 1: 194,621,266 (GRCm39) probably benign Het
Cd69 T A 6: 129,246,954 (GRCm39) M88L probably benign Het
Ces2h A G 8: 105,745,057 (GRCm39) E397G probably benign Het
Ddx60 T C 8: 62,463,036 (GRCm39) F1306L possibly damaging Het
Dennd5b T C 6: 148,901,514 (GRCm39) E1124G probably damaging Het
Dio1 A T 4: 107,164,185 (GRCm39) M44K probably damaging Het
Elapor2 A T 5: 9,529,247 (GRCm39) N1027Y probably damaging Het
En1 A G 1: 120,531,324 (GRCm39) D188G probably damaging Het
Epha10 C T 4: 124,807,914 (GRCm39) probably benign Het
Fam120b A T 17: 15,623,388 (GRCm39) L455F possibly damaging Het
Flt4 AC ACC 11: 49,541,861 (GRCm39) probably null Het
Incenp A G 19: 9,855,039 (GRCm39) probably null Het
Kansl3 A G 1: 36,397,230 (GRCm39) V86A possibly damaging Het
Klhl7 C G 5: 24,331,918 (GRCm39) F73L probably damaging Het
Med28 T A 5: 45,682,541 (GRCm39) V69D probably damaging Het
Mknk1 C A 4: 115,721,749 (GRCm39) L98M probably damaging Het
Mknk1 T A 4: 115,721,750 (GRCm39) L98Q probably damaging Het
Myo3b T A 2: 69,935,724 (GRCm39) C97S probably damaging Het
Neto1 A G 18: 86,414,033 (GRCm39) H9R possibly damaging Het
Omd A T 13: 49,745,703 (GRCm39) E371V probably benign Het
Or1n2 A T 2: 36,797,833 (GRCm39) I292F probably damaging Het
Or2w3b T C 11: 58,623,146 (GRCm39) T282A possibly damaging Het
Or4c123 T C 2: 89,127,257 (GRCm39) D119G probably damaging Het
Or51e2 G A 7: 102,391,637 (GRCm39) T191I probably benign Het
Osbpl9 G T 4: 108,919,497 (GRCm39) Y733* probably null Het
Pcdh12 A T 18: 38,401,951 (GRCm39) S91R probably damaging Het
Pxk C A 14: 8,136,911 (GRCm38) P144Q probably benign Het
Qser1 A G 2: 104,620,219 (GRCm39) S198P probably damaging Het
Recql T G 6: 142,308,073 (GRCm39) probably benign Het
Reln T C 5: 22,184,712 (GRCm39) D1601G probably damaging Het
Scn10a T C 9: 119,438,100 (GRCm39) D1922G probably damaging Het
Scn11a T A 9: 119,598,974 (GRCm39) R1185S probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Shoc1 A G 4: 59,082,432 (GRCm39) S399P possibly damaging Het
Slc13a4 A T 6: 35,278,777 (GRCm39) C37* probably null Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc9a9 T A 9: 94,594,954 (GRCm39) F155I probably damaging Het
Spef2 T A 15: 9,614,367 (GRCm39) K1193M probably damaging Het
Tmc1 A G 19: 20,781,966 (GRCm39) I584T probably damaging Het
Tsc22d1 C A 14: 76,654,494 (GRCm39) F324L probably benign Het
Usp19 T C 9: 108,377,392 (GRCm39) V1236A probably damaging Het
Vmn2r63 T C 7: 42,577,635 (GRCm39) N301S probably benign Het
Wrn C T 8: 33,784,945 (GRCm39) V476I probably benign Het
Zbed6 G A 1: 133,585,879 (GRCm39) T486I probably damaging Het
Zbtb25 C A 12: 76,396,476 (GRCm39) E249* probably null Het
Zfp54 C A 17: 21,653,962 (GRCm39) T152K probably benign Het
Other mutations in Swt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Swt1 APN 1 151,286,890 (GRCm39) missense probably damaging 0.99
IGL01622:Swt1 APN 1 151,286,760 (GRCm39) missense probably benign 0.01
IGL01623:Swt1 APN 1 151,286,760 (GRCm39) missense probably benign 0.01
IGL01672:Swt1 APN 1 151,270,359 (GRCm39) critical splice donor site probably null
IGL01693:Swt1 APN 1 151,297,855 (GRCm39) missense probably benign 0.02
IGL02203:Swt1 APN 1 151,246,377 (GRCm39) missense probably benign 0.01
IGL03223:Swt1 APN 1 151,255,170 (GRCm39) missense possibly damaging 0.80
R0124:Swt1 UTSW 1 151,267,280 (GRCm39) missense probably damaging 1.00
R0496:Swt1 UTSW 1 151,287,021 (GRCm39) missense probably benign
R1037:Swt1 UTSW 1 151,246,320 (GRCm39) splice site probably benign
R1171:Swt1 UTSW 1 151,281,272 (GRCm39) missense probably damaging 1.00
R1270:Swt1 UTSW 1 151,260,142 (GRCm39) missense probably benign 0.00
R1883:Swt1 UTSW 1 151,299,284 (GRCm39) nonsense probably null
R2051:Swt1 UTSW 1 151,248,081 (GRCm39) missense probably damaging 1.00
R2110:Swt1 UTSW 1 151,279,636 (GRCm39) missense probably damaging 0.97
R2185:Swt1 UTSW 1 151,260,219 (GRCm39) missense probably damaging 1.00
R3688:Swt1 UTSW 1 151,267,240 (GRCm39) missense probably damaging 0.99
R3785:Swt1 UTSW 1 151,255,155 (GRCm39) missense probably benign 0.03
R4074:Swt1 UTSW 1 151,270,520 (GRCm39) missense probably benign
R4157:Swt1 UTSW 1 151,278,795 (GRCm39) missense probably damaging 1.00
R4660:Swt1 UTSW 1 151,283,348 (GRCm39) missense probably benign 0.18
R4761:Swt1 UTSW 1 151,276,853 (GRCm39) missense probably benign 0.43
R4972:Swt1 UTSW 1 151,299,293 (GRCm39) missense probably benign 0.22
R5141:Swt1 UTSW 1 151,287,145 (GRCm39) missense probably benign 0.04
R5227:Swt1 UTSW 1 151,278,727 (GRCm39) nonsense probably null
R5580:Swt1 UTSW 1 151,260,206 (GRCm39) missense probably benign 0.00
R5912:Swt1 UTSW 1 151,287,160 (GRCm39) missense probably damaging 1.00
R5945:Swt1 UTSW 1 151,286,921 (GRCm39) missense probably benign 0.01
R5973:Swt1 UTSW 1 151,278,700 (GRCm39) splice site probably null
R5979:Swt1 UTSW 1 151,283,339 (GRCm39) missense possibly damaging 0.94
R6242:Swt1 UTSW 1 151,283,365 (GRCm39) missense probably benign 0.41
R6283:Swt1 UTSW 1 151,260,084 (GRCm39) missense possibly damaging 0.78
R6951:Swt1 UTSW 1 151,273,019 (GRCm39) missense possibly damaging 0.88
R7009:Swt1 UTSW 1 151,246,381 (GRCm39) missense possibly damaging 0.94
R7165:Swt1 UTSW 1 151,264,428 (GRCm39) missense probably damaging 1.00
R7214:Swt1 UTSW 1 151,270,364 (GRCm39) missense possibly damaging 0.63
R7403:Swt1 UTSW 1 151,264,444 (GRCm39) missense probably benign 0.01
R7439:Swt1 UTSW 1 151,286,815 (GRCm39) missense probably benign 0.04
R7441:Swt1 UTSW 1 151,286,815 (GRCm39) missense probably benign 0.04
R7571:Swt1 UTSW 1 151,270,470 (GRCm39) missense probably benign 0.00
R8028:Swt1 UTSW 1 151,260,248 (GRCm39) missense probably benign 0.26
R8225:Swt1 UTSW 1 151,297,859 (GRCm39) missense possibly damaging 0.96
R9075:Swt1 UTSW 1 151,246,245 (GRCm39) intron probably benign
R9100:Swt1 UTSW 1 151,299,256 (GRCm39) critical splice donor site probably null
R9135:Swt1 UTSW 1 151,244,239 (GRCm39) missense possibly damaging 0.61
R9291:Swt1 UTSW 1 151,286,694 (GRCm39) missense probably damaging 0.96
R9292:Swt1 UTSW 1 151,278,787 (GRCm39) missense probably benign 0.00
R9368:Swt1 UTSW 1 151,286,767 (GRCm39) missense possibly damaging 0.90
X0062:Swt1 UTSW 1 151,287,190 (GRCm39) missense probably benign 0.43
Z1176:Swt1 UTSW 1 151,264,436 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTGACATAGCCCAGTGC -3'
(R):5'- CTATGAAGGCTCTATGCTCCAG -3'

Sequencing Primer
(F):5'- GCCCAGTGCTTGCCTAG -3'
(R):5'- AAGGCTCTATGCTCCAGTGTGG -3'
Posted On 2016-09-06