Incidental Mutation 'R5400:Myo3b'
ID429915
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70105380 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 97 (C97S)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112241] [ENSMUST00000112243]
Predicted Effect probably damaging
Transcript: ENSMUST00000060208
AA Change: C125S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: C125S

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112241
AA Change: C46S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107860
Gene: ENSMUSG00000042064
AA Change: C46S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 187 3.7e-30 PFAM
Pfam:Pkinase 1 188 8.3e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: C97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: C97S

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.8387 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7944:Myo3b UTSW 2 70108688 missense probably damaging 1.00
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTTCTGGTATCAGCATAAATCAC -3'
(R):5'- GGTTATTCCATCCCGAAGTTTAC -3'

Sequencing Primer
(F):5'- CTGGTATCAGCATAAATCACTACTC -3'
(R):5'- GAAGTTTACTCTCCATAGTTCACGTG -3'
Posted On2016-09-06