Mutagenetix > Incidental Mutations

Incidental Mutation 'R5400:AI481877'

429919

Institutional Source

Beutler Lab

Gene Symbol

AI481877

Ensembl Gene

ENSMUSG00000038598

Gene Name

expressed sequence AI481877

Synonyms

LOC242489, Gm426

MMRRC Submission

042971-MU

Accession Numbers

Genbank: XM_001476641.2; Ensembl: ENSMUST00000107547

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R5400 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59043753-59138983 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59082432 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 399 (S399P)

Ref Sequence

ENSEMBL: ENSMUSP00000103171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107547]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107547
AA Change: S399P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103171
Gene: ENSMUSG00000038598
AA Change: S399P

Domain	Start	End	E-Value	Type
low complexity region	246	264	N/A	INTRINSIC
low complexity region	543	560	N/A	INTRINSIC
low complexity region	908	917	N/A	INTRINSIC
low complexity region	1189	1201	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122832

Meta Mutation Damage Score

0.1492

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

98% (64/65)

Allele List at MGI

All alleles(6) : Targeted, other(1) Gene trapped(5)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	T	5: 9,479,247	N1027Y	probably damaging	Het
Accsl	T	C	2: 93,859,422	D380G	probably damaging	Het
Afm	T	C	5: 90,551,398	L567P	possibly damaging	Het
Anks1b	A	T	10: 90,512,824	I785L	probably damaging	Het
Arpc5l	G	A	2: 39,013,735	G79S	probably benign	Het
Arvcf	G	T	16: 18,399,070	R440L	probably benign	Het
Atm	T	C	9: 53,503,018	D924G	probably damaging	Het
Atp8b1	A	T	18: 64,545,989		probably null	Het
Cd19	C	T	7: 126,414,452	G55D	probably benign	Het
Cd34	A	G	1: 194,938,958		probably benign	Het
Cd69	T	A	6: 129,269,991	M88L	probably benign	Het
Ces2h	A	G	8: 105,018,425	E397G	probably benign	Het
Ddx60	T	C	8: 62,010,002	F1306L	possibly damaging	Het
Dennd5b	T	C	6: 149,000,016	E1124G	probably damaging	Het
Dio1	A	T	4: 107,306,988	M44K	probably damaging	Het
En1	A	G	1: 120,603,595	D188G	probably damaging	Het
Epha10	C	T	4: 124,914,121		probably benign	Het
Fam120b	A	T	17: 15,403,126	L455F	possibly damaging	Het
Flt4	AC	ACC	11: 49,651,034		probably null	Het
Gm38394	G	A	1: 133,658,141	T486I	probably damaging	Het
Incenp	A	G	19: 9,877,675		probably null	Het
Kansl3	A	G	1: 36,358,149	V86A	possibly damaging	Het
Klhl7	C	G	5: 24,126,920	F73L	probably damaging	Het
Med28	T	A	5: 45,525,199	V69D	probably damaging	Het
Mknk1	C	A	4: 115,864,552	L98M	probably damaging	Het
Mknk1	T	A	4: 115,864,553	L98Q	probably damaging	Het
Myo3b	T	A	2: 70,105,380	C97S	probably damaging	Het
Neto1	A	G	18: 86,395,908	H9R	possibly damaging	Het
Olfr1230	T	C	2: 89,296,913	D119G	probably damaging	Het
Olfr317	T	C	11: 58,732,320	T282A	possibly damaging	Het
Olfr354	A	T	2: 36,907,821	I292F	probably damaging	Het
Olfr78	G	A	7: 102,742,430	T191I	probably benign	Het
Omd	A	T	13: 49,592,227	E371V	probably benign	Het
Osbpl9	G	T	4: 109,062,300	Y733*	probably null	Het
Pcdh12	A	T	18: 38,268,898	S91R	probably damaging	Het
Pxk	C	A	14: 8,136,911	P144Q	probably benign	Het
Qser1	A	G	2: 104,789,874	S198P	probably damaging	Het
Recql	T	G	6: 142,362,347		probably benign	Het
Reln	T	C	5: 21,979,714	D1601G	probably damaging	Het
Scn10a	T	C	9: 119,609,034	D1922G	probably damaging	Het
Scn11a	T	A	9: 119,769,908	R1185S	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc13a4	A	T	6: 35,301,842	C37*	probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc9a9	T	A	9: 94,712,901	F155I	probably damaging	Het
Spef2	T	A	15: 9,614,281	K1193M	probably damaging	Het
Swt1	T	C	1: 151,412,834	T80A	probably benign	Het
Tmc1	A	G	19: 20,804,602	I584T	probably damaging	Het
Tsc22d1	C	A	14: 76,417,054	F324L	probably benign	Het
Usp19	T	C	9: 108,500,193	V1236A	probably damaging	Het
Vmn2r63	T	C	7: 42,928,211	N301S	probably benign	Het
Wrn	C	T	8: 33,294,917	V476I	probably benign	Het
Zbtb25	C	A	12: 76,349,702	E249*	probably null	Het
Zfp54	C	A	17: 21,433,700	T152K	probably benign	Het

Other mutations in AI481877

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:AI481877	APN	4	59086961	missense	probably benign
IGL00574:AI481877	APN	4	59094201	missense	possibly damaging	0.66
IGL01333:AI481877	APN	4	59047870	missense	possibly damaging	0.66
IGL02282:AI481877	APN	4	59111114	missense	unknown
IGL02418:AI481877	APN	4	59049075	splice site	probably benign
IGL02621:AI481877	APN	4	59062668	missense	probably damaging	0.97
IGL03028:AI481877	APN	4	59094274	missense	possibly damaging	0.66
IGL03112:AI481877	APN	4	59049355	missense	probably benign	0.27
IGL03137:AI481877	APN	4	59094162	missense	probably benign	0.27
IGL03220:AI481877	APN	4	59082378	nonsense	probably null
IGL03386:AI481877	APN	4	59069315	missense	possibly damaging	0.66
1mM(1):AI481877	UTSW	4	59048024	nonsense	probably null
R0071:AI481877	UTSW	4	59059643	missense	possibly damaging	0.92
R0071:AI481877	UTSW	4	59059643	missense	possibly damaging	0.92
R0194:AI481877	UTSW	4	59066534	splice site	probably benign
R0366:AI481877	UTSW	4	59099410	missense	probably benign	0.09
R0680:AI481877	UTSW	4	59043967	missense	probably benign	0.00
R1419:AI481877	UTSW	4	59064457	missense	possibly damaging	0.66
R1599:AI481877	UTSW	4	59072349	missense	possibly damaging	0.82
R1699:AI481877	UTSW	4	59113926	missense	unknown
R1799:AI481877	UTSW	4	59099383	missense	possibly damaging	0.92
R1832:AI481877	UTSW	4	59066441	missense	probably benign	0.05
R1870:AI481877	UTSW	4	59054142	splice site	probably benign
R2076:AI481877	UTSW	4	59082410	missense	possibly damaging	0.46
R2170:AI481877	UTSW	4	59069215	missense	possibly damaging	0.92
R2870:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2870:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2871:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2871:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2872:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2872:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2873:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R3026:AI481877	UTSW	4	59062656	missense	possibly damaging	0.83
R3079:AI481877	UTSW	4	59047848	missense	possibly damaging	0.82
R3853:AI481877	UTSW	4	59047390	missense	possibly damaging	0.66
R3914:AI481877	UTSW	4	59094201	missense	possibly damaging	0.66
R4006:AI481877	UTSW	4	59076500	missense	possibly damaging	0.53
R4364:AI481877	UTSW	4	59082294	missense	possibly damaging	0.92
R4387:AI481877	UTSW	4	59060915	missense	possibly damaging	0.66
R4454:AI481877	UTSW	4	59092383	missense	possibly damaging	0.90
R4811:AI481877	UTSW	4	59082404	missense	probably benign	0.19
R4853:AI481877	UTSW	4	59072345	missense	possibly damaging	0.66
R4899:AI481877	UTSW	4	59062640	missense	probably damaging	0.97
R5090:AI481877	UTSW	4	59111108	missense	unknown
R5169:AI481877	UTSW	4	59059618	missense	possibly damaging	0.66
R5297:AI481877	UTSW	4	59047543	missense	probably benign
R5419:AI481877	UTSW	4	59049017	missense	probably benign	0.04
R5668:AI481877	UTSW	4	59047399	missense	probably benign
R5770:AI481877	UTSW	4	59092466	missense	probably benign	0.00
R5783:AI481877	UTSW	4	59076239	nonsense	probably null
R5929:AI481877	UTSW	4	59092497	nonsense	probably null
R6209:AI481877	UTSW	4	59043869	makesense	probably null
R6230:AI481877	UTSW	4	59099345	missense	probably benign
R6233:AI481877	UTSW	4	59076245	missense	possibly damaging	0.92
R6351:AI481877	UTSW	4	59069317	missense	probably benign	0.00
R6785:AI481877	UTSW	4	59049066	missense	probably benign	0.01
R6884:AI481877	UTSW	4	59059652	missense	possibly damaging	0.83
R7355:AI481877	UTSW	4	59076155	missense	probably benign
R7423:AI481877	UTSW	4	59076264	missense	probably benign	0.27
R7484:AI481877	UTSW	4	59062286	missense	probably damaging	0.97
R7560:AI481877	UTSW	4	59076140	missense	possibly damaging	0.66
R7999:AI481877	UTSW	4	59094162	missense	probably benign	0.27
R8198:AI481877	UTSW	4	59065174	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GCTGAAACACTTTTGTAGGCAG -3'
(R):5'- TGGAGGGATTAACTTCTTGATAGTC -3'

Sequencing Primer
(F):5'- AGAAAGATCTCCAGCTTAGTCTCCTG -3'
(R):5'- GGTAAGTTGCCACACACCTGTAG -3'

Posted On

2016-09-06