Incidental Mutation 'R5400:Dio1'
ID429920
Institutional Source Beutler Lab
Gene Symbol Dio1
Ensembl Gene ENSMUSG00000034785
Gene Namedeiodinase, iodothyronine, type I
SynonymsD1
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location107291465-107307169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107306988 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 44 (M44K)
Ref Sequence ENSEMBL: ENSMUSP00000118335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082426] [ENSMUST00000106748] [ENSMUST00000126291] [ENSMUST00000129138] [ENSMUST00000134366] [ENSMUST00000147709] [ENSMUST00000150974]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082426
AA Change: M44K

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081007
Gene: ENSMUSG00000034785
AA Change: M44K

DomainStartEndE-ValueType
Pfam:T4_deiodinase 8 248 8.8e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106748
AA Change: M44K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102359
Gene: ENSMUSG00000034785
AA Change: M44K

DomainStartEndE-ValueType
Pfam:T4_deiodinase 8 113 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126291
SMART Domains Protein: ENSMUSP00000114807
Gene: ENSMUSG00000034785

DomainStartEndE-ValueType
Pfam:T4_deiodinase 1 62 8.3e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129138
AA Change: M44K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118335
Gene: ENSMUSG00000034785
AA Change: M44K

DomainStartEndE-ValueType
Pfam:T4_deiodinase 8 113 7e-24 PFAM
Pfam:T4_deiodinase 111 200 5.3e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134366
AA Change: M44K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119199
Gene: ENSMUSG00000034785
AA Change: M44K

DomainStartEndE-ValueType
Pfam:T4_deiodinase 8 79 9.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145332
Predicted Effect possibly damaging
Transcript: ENSMUST00000147709
AA Change: M44K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121450
Gene: ENSMUSG00000034785
AA Change: M44K

DomainStartEndE-ValueType
Pfam:T4_deiodinase 8 79 9.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150974
AA Change: M44K

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117751
Gene: ENSMUSG00000034785
AA Change: M44K

DomainStartEndE-ValueType
Pfam:T4_deiodinase 8 125 2.5e-34 PFAM
Meta Mutation Damage Score 0.7160 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the iodothyronine deiodinase family. It catalyzes the activation, as well as the inactivation of thyroid hormone by outer and inner ring deiodination, respectively. The activation reaction involves the conversion of the prohormone thyroxine (3,5,3',5'-tetraiodothyronine, T4), secreted by the thyroid gland, to the bioactive thyroid hormone (3,5,3'-triiodothyronine, T3) by 5'-deiodination. This protein is expressed predominantly in the liver and kidney and provides most of the circulating T3, which is essential for growth, differentiation and basal metabolism in vertebrates. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene display elevated thyroxine (T4) and reverse triiodothyronine (rT3) levels and changes in the metabolism and excretion of iodothyronines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Dio1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Dio1 APN 4 107293781 missense probably damaging 1.00
IGL02476:Dio1 APN 4 107292377 missense probably damaging 1.00
R1944:Dio1 UTSW 4 107306780 critical splice donor site probably null
R5433:Dio1 UTSW 4 107306780 critical splice donor site probably benign
R6810:Dio1 UTSW 4 107297725 missense probably damaging 1.00
R6978:Dio1 UTSW 4 107306833 missense probably benign 0.20
R7485:Dio1 UTSW 4 107297677 missense probably benign 0.04
R7579:Dio1 UTSW 4 107292386 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTGCACTTCTGTCCTGAGAGG -3'
(R):5'- TAGCCTGCACCTTTGTCCAG -3'

Sequencing Primer
(F):5'- GCAGACCACGGTGCAGTTG -3'
(R):5'- TGTCCAGCTCCACCCAGTG -3'
Posted On2016-09-06