Incidental Mutation 'R5400:Mknk1'
ID429922
Institutional Source Beutler Lab
Gene Symbol Mknk1
Ensembl Gene ENSMUSG00000028708
Gene NameMAP kinase-interacting serine/threonine kinase 1
SynonymsMnk1, 2410048M24Rik
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115839198-115879250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115864552 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 98 (L98M)
Ref Sequence ENSEMBL: ENSMUSP00000117261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019677] [ENSMUST00000106513] [ENSMUST00000130819] [ENSMUST00000144427] [ENSMUST00000151203]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019677
AA Change: L98M

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019677
Gene: ENSMUSG00000028708
AA Change: L98M

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
S_TKc 37 321 2.01e-87 SMART
low complexity region 363 378 N/A INTRINSIC
low complexity region 383 404 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106513
AA Change: L98M

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102123
Gene: ENSMUSG00000028708
AA Change: L98M

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
S_TKc 37 321 2.01e-87 SMART
low complexity region 363 378 N/A INTRINSIC
low complexity region 383 404 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130819
AA Change: L98M

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118071
Gene: ENSMUSG00000028708
AA Change: L98M

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
STYKc 37 140 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144235
Predicted Effect probably damaging
Transcript: ENSMUST00000144427
AA Change: L98M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117261
Gene: ENSMUSG00000028708
AA Change: L98M

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
Pfam:Pkinase 37 101 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150201
Predicted Effect possibly damaging
Transcript: ENSMUST00000151203
AA Change: L98M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114941
Gene: ENSMUSG00000028708
AA Change: L98M

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
Pfam:Pkinase 37 114 4.7e-12 PFAM
Pfam:Pkinase_Tyr 38 114 7.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154957
Meta Mutation Damage Score 0.5900 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: This gene encodes a serine-threonine protein kinase that is activated by extracellular signal-regulated kinase or p38 mitogen-activated protein kinases, and it may function in cytokine and environmental stress responses. This kinase is required for phosphorylation of eukaryotic translation initiation factor 4E but it is not required for cell growth during development. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous null mice are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Mknk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Mknk1 APN 4 115875534 missense probably damaging 1.00
IGL02538:Mknk1 APN 4 115860091 nonsense probably null
IGL02927:Mknk1 APN 4 115857091 missense probably damaging 1.00
R1845:Mknk1 UTSW 4 115873231 nonsense probably null
R1943:Mknk1 UTSW 4 115863026 missense probably damaging 0.98
R2278:Mknk1 UTSW 4 115875493 missense probably damaging 0.99
R4027:Mknk1 UTSW 4 115864561 missense probably damaging 0.99
R4604:Mknk1 UTSW 4 115878027 missense probably damaging 0.96
R4833:Mknk1 UTSW 4 115878186 utr 3 prime probably benign
R5400:Mknk1 UTSW 4 115864553 missense probably damaging 1.00
R5712:Mknk1 UTSW 4 115855006 splice site probably null
R5941:Mknk1 UTSW 4 115876637 splice site probably benign
R7038:Mknk1 UTSW 4 115857110 missense probably damaging 0.99
R7146:Mknk1 UTSW 4 115864592 missense probably damaging 0.99
R7606:Mknk1 UTSW 4 115877994 missense probably damaging 0.98
R7747:Mknk1 UTSW 4 115878072 missense possibly damaging 0.96
X0050:Mknk1 UTSW 4 115857055 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGCTAACACTGTGGGCTGC -3'
(R):5'- ATTCTAAGCGCTGCAAAATGC -3'

Sequencing Primer
(F):5'- GGCTGCTTCTCAAACATGAG -3'
(R):5'- CCAAGGGCAGTTTTTAAGTCC -3'
Posted On2016-09-06