Incidental Mutation 'R5400:Afm'
ID429929
Institutional Source Beutler Lab
Gene Symbol Afm
Ensembl Gene ENSMUSG00000029369
Gene Nameafamin
Synonymsalpha albumin, Alf
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location90518932-90553543 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90551398 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 567 (L567P)
Ref Sequence ENSEMBL: ENSMUSP00000108804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113179] [ENSMUST00000128740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113179
AA Change: L567P

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108804
Gene: ENSMUSG00000029369
AA Change: L567P

DomainStartEndE-ValueType
ALBUMIN 20 205 3.69e-55 SMART
ALBUMIN 212 397 6.42e-64 SMART
ALBUMIN 404 593 3.07e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128740
SMART Domains Protein: ENSMUSP00000117180
Gene: ENSMUSG00000029369

DomainStartEndE-ValueType
ALBUMIN 20 205 3.69e-55 SMART
ALBUMIN 212 397 6.42e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200893
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Afm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Afm APN 5 90525591 missense probably benign 0.01
IGL01140:Afm APN 5 90524867 missense probably damaging 1.00
IGL01789:Afm APN 5 90525584 missense probably benign 0.32
IGL01819:Afm APN 5 90524906 missense probably benign 0.01
IGL01826:Afm APN 5 90524928 splice site probably benign
IGL01875:Afm APN 5 90548883 utr 3 prime probably benign
IGL02337:Afm APN 5 90547911 missense probably benign
IGL02902:Afm APN 5 90526363 missense possibly damaging 0.58
IGL02950:Afm APN 5 90531607 missense probably damaging 1.00
R0009:Afm UTSW 5 90545384 splice site probably benign
R0009:Afm UTSW 5 90545384 splice site probably benign
R0135:Afm UTSW 5 90550322 missense probably benign 0.00
R0582:Afm UTSW 5 90524780 splice site probably benign
R1416:Afm UTSW 5 90526379 missense possibly damaging 0.74
R1465:Afm UTSW 5 90550341 missense probably damaging 1.00
R1465:Afm UTSW 5 90550341 missense probably damaging 1.00
R1834:Afm UTSW 5 90526424 missense probably benign 0.01
R1919:Afm UTSW 5 90524920 nonsense probably null
R2071:Afm UTSW 5 90523735 missense probably benign 0.17
R2843:Afm UTSW 5 90526465 nonsense probably null
R2979:Afm UTSW 5 90522163 missense probably benign 0.19
R4853:Afm UTSW 5 90551467 missense probably damaging 1.00
R5551:Afm UTSW 5 90531652 missense probably null 0.97
R5583:Afm UTSW 5 90547881 missense probably damaging 1.00
R5780:Afm UTSW 5 90551431 missense possibly damaging 0.87
R7378:Afm UTSW 5 90551400 missense probably benign 0.00
R7470:Afm UTSW 5 90531627 missense probably damaging 0.99
R7785:Afm UTSW 5 90550173 missense possibly damaging 0.93
R7799:Afm UTSW 5 90523854 missense probably benign 0.00
R7809:Afm UTSW 5 90524816 missense probably damaging 1.00
R7897:Afm UTSW 5 90547868 missense probably benign 0.00
R8236:Afm UTSW 5 90523888 missense probably damaging 1.00
R8497:Afm UTSW 5 90551343 critical splice acceptor site probably null
R8752:Afm UTSW 5 90552565 missense probably benign 0.00
X0022:Afm UTSW 5 90545414 missense probably damaging 1.00
Z1177:Afm UTSW 5 90521946 missense probably benign 0.05
Z1177:Afm UTSW 5 90531506 missense probably benign 0.07
Z1177:Afm UTSW 5 90531616 missense probably damaging 1.00
Z1177:Afm UTSW 5 90551383 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CGTAAGACCCTTGCAGAAGTG -3'
(R):5'- GCTTTGTGCTCTGACACAC -3'

Sequencing Primer
(F):5'- GCTGTAGGGAGGATCATT -3'
(R):5'- CAGAACGACTGGACATGTAGAAAAG -3'
Posted On2016-09-06