Incidental Mutation 'R5400:Dennd5b'
ID429933
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene NameDENN/MADD domain containing 5B
Synonyms9330160C06Rik, D030011O10Rik
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location148988071-149101680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149000016 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1124 (E1124G)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
Predicted Effect probably damaging
Transcript: ENSMUST00000111557
AA Change: E1124G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: E1124G

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117470
Meta Mutation Damage Score 0.4630 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 149027330 missense probably damaging 1.00
IGL00590:Dennd5b APN 6 149068308 missense probably benign 0.03
IGL00727:Dennd5b APN 6 149006716 splice site probably benign
IGL00838:Dennd5b APN 6 149005363 splice site probably benign
IGL01115:Dennd5b APN 6 149009748 splice site probably benign
IGL01150:Dennd5b APN 6 149068085 missense probably benign 0.01
IGL01873:Dennd5b APN 6 149044529 missense probably benign
IGL01991:Dennd5b APN 6 149080824 missense probably damaging 1.00
IGL02226:Dennd5b APN 6 149033301 missense probably benign 0.00
IGL02820:Dennd5b APN 6 149019342 missense probably null 0.51
IGL03056:Dennd5b APN 6 149055072 missense probably damaging 1.00
IGL03085:Dennd5b APN 6 149027395 missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148998260 missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148993759 missense probably benign 0.13
R0617:Dennd5b UTSW 6 149033262 splice site probably benign
R1241:Dennd5b UTSW 6 149068490 missense probably benign 0.06
R1252:Dennd5b UTSW 6 149044487 missense probably damaging 1.00
R1255:Dennd5b UTSW 6 149041650 missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 149068205 missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148998284 missense probably damaging 1.00
R1781:Dennd5b UTSW 6 149027398 missense probably damaging 1.00
R1861:Dennd5b UTSW 6 149068262 missense probably damaging 1.00
R1907:Dennd5b UTSW 6 149041576 missense probably benign 0.00
R2412:Dennd5b UTSW 6 149005238 missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149101217 missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 149044836 missense probably benign
R4581:Dennd5b UTSW 6 149016984 splice site silent
R4654:Dennd5b UTSW 6 149006837 missense probably damaging 1.00
R4725:Dennd5b UTSW 6 149044779 missense probably damaging 0.97
R4981:Dennd5b UTSW 6 149009772 missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 149041500 splice site probably null
R5452:Dennd5b UTSW 6 149041513 splice site probably null
R5548:Dennd5b UTSW 6 149019349 splice site probably null
R5841:Dennd5b UTSW 6 149044755 missense probably benign 0.11
R5996:Dennd5b UTSW 6 149068095 missense probably benign 0.22
R6082:Dennd5b UTSW 6 149068695 missense probably damaging 0.99
R6556:Dennd5b UTSW 6 149014251 splice site probably null
R6812:Dennd5b UTSW 6 149081132 start gained probably benign
R6828:Dennd5b UTSW 6 148993746 missense probably damaging 0.99
R7104:Dennd5b UTSW 6 149044604 missense probably damaging 1.00
R7231:Dennd5b UTSW 6 149044604 missense probably damaging 1.00
R7325:Dennd5b UTSW 6 149020570 missense probably benign 0.00
R7399:Dennd5b UTSW 6 149036483 missense probably damaging 1.00
R7516:Dennd5b UTSW 6 149068380 missense probably benign 0.02
R7751:Dennd5b UTSW 6 149017106 missense probably benign 0.01
R7763:Dennd5b UTSW 6 149068658 missense probably damaging 1.00
R7770:Dennd5b UTSW 6 149041716 missense probably damaging 0.99
R7788:Dennd5b UTSW 6 149068566 missense probably benign 0.00
R7854:Dennd5b UTSW 6 149068466 missense probably benign 0.00
R7899:Dennd5b UTSW 6 149041661 missense probably damaging 1.00
R8226:Dennd5b UTSW 6 149014248 splice site probably null
R8328:Dennd5b UTSW 6 149020617 missense probably damaging 1.00
R8489:Dennd5b UTSW 6 149084891 missense probably benign 0.00
R8517:Dennd5b UTSW 6 149029121 missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148993770 missense probably damaging 1.00
R8693:Dennd5b UTSW 6 149009774 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGCCCAAAACATACTAGTT -3'
(R):5'- CAGCTCTTTAATTCTCTAGTGTGGT -3'

Sequencing Primer
(F):5'- GCTGGCTTCAAATTCAGAGATCC -3'
(R):5'- TTAGATCCCCTGGAACTACGTCTAAG -3'
Posted On2016-09-06