Incidental Mutation 'R5400:Vmn2r63'
ID429934
Institutional Source Beutler Lab
Gene Symbol Vmn2r63
Ensembl Gene ENSMUSG00000090751
Gene Namevomeronasal 2, receptor 63
SynonymsEG435975
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42903251-42933789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42928211 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 301 (N301S)
Ref Sequence ENSEMBL: ENSMUSP00000129089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163803]
Predicted Effect probably benign
Transcript: ENSMUST00000163803
AA Change: N301S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129089
Gene: ENSMUSG00000090751
AA Change: N301S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 3.5e-43 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 3.5e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Vmn2r63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Vmn2r63 APN 7 42904119 missense probably damaging 0.99
IGL01765:Vmn2r63 APN 7 42903364 missense probably benign
IGL02203:Vmn2r63 APN 7 42904008 missense probably benign 0.01
IGL02825:Vmn2r63 APN 7 42926850 critical splice donor site probably null
IGL03155:Vmn2r63 APN 7 42903454 missense probably damaging 1.00
IGL03260:Vmn2r63 APN 7 42929192 missense probably damaging 1.00
IGL03411:Vmn2r63 APN 7 42927944 missense probably benign 0.42
PIT4280001:Vmn2r63 UTSW 7 42903985 missense probably damaging 1.00
R0066:Vmn2r63 UTSW 7 42927090 splice site probably benign
R0328:Vmn2r63 UTSW 7 42903275 missense probably benign 0.09
R0344:Vmn2r63 UTSW 7 42903618 missense probably damaging 0.98
R0554:Vmn2r63 UTSW 7 42933705 nonsense probably null
R0555:Vmn2r63 UTSW 7 42928528 nonsense probably null
R0685:Vmn2r63 UTSW 7 42928010 missense probably benign 0.13
R0751:Vmn2r63 UTSW 7 42928035 missense probably damaging 1.00
R1349:Vmn2r63 UTSW 7 42929218 missense possibly damaging 0.95
R1372:Vmn2r63 UTSW 7 42929218 missense possibly damaging 0.95
R1416:Vmn2r63 UTSW 7 42927915 missense probably benign 0.00
R1502:Vmn2r63 UTSW 7 42928591 missense possibly damaging 0.62
R1563:Vmn2r63 UTSW 7 42904126 missense probably benign 0.00
R1652:Vmn2r63 UTSW 7 42928211 missense probably benign 0.32
R1693:Vmn2r63 UTSW 7 42928319 missense probably benign
R1698:Vmn2r63 UTSW 7 42933614 missense probably benign
R1753:Vmn2r63 UTSW 7 42928245 nonsense probably null
R2136:Vmn2r63 UTSW 7 42926873 missense probably damaging 0.99
R2175:Vmn2r63 UTSW 7 42933580 critical splice donor site probably null
R2261:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R2262:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R2263:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R3413:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3426:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3427:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3802:Vmn2r63 UTSW 7 42903405 missense probably damaging 0.99
R4319:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4321:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4323:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4346:Vmn2r63 UTSW 7 42928113 missense possibly damaging 0.67
R4568:Vmn2r63 UTSW 7 42933826 splice site probably null
R4649:Vmn2r63 UTSW 7 42903690 missense possibly damaging 0.79
R4653:Vmn2r63 UTSW 7 42903690 missense possibly damaging 0.79
R4679:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4734:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4741:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4748:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4806:Vmn2r63 UTSW 7 42926890 missense probably benign 0.34
R4933:Vmn2r63 UTSW 7 42903978 missense probably damaging 1.00
R5198:Vmn2r63 UTSW 7 42903745 missense probably benign 0.01
R5399:Vmn2r63 UTSW 7 42928277 missense probably benign
R6158:Vmn2r63 UTSW 7 42933680 missense probably damaging 1.00
R6185:Vmn2r63 UTSW 7 42929011 missense probably damaging 0.98
R6267:Vmn2r63 UTSW 7 42928635 splice site probably null
R6362:Vmn2r63 UTSW 7 42903297 missense probably benign
R6706:Vmn2r63 UTSW 7 42928577 missense probably damaging 1.00
R6764:Vmn2r63 UTSW 7 42903271 missense probably damaging 0.97
R7104:Vmn2r63 UTSW 7 42928535 missense possibly damaging 0.67
R7503:Vmn2r63 UTSW 7 42933590 missense probably benign 0.02
R7506:Vmn2r63 UTSW 7 42926967 missense probably damaging 1.00
R7525:Vmn2r63 UTSW 7 42926982 missense possibly damaging 0.52
R7658:Vmn2r63 UTSW 7 42925269 missense probably damaging 1.00
R7663:Vmn2r63 UTSW 7 42927042 missense probably benign 0.00
R7702:Vmn2r63 UTSW 7 42928129 missense possibly damaging 0.46
R7918:Vmn2r63 UTSW 7 42903531 missense probably damaging 1.00
Z1088:Vmn2r63 UTSW 7 42928559 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTTGGCAGTTCTCCAAAAGTTG -3'
(R):5'- GAAAATGATTCCTGGCACCTGG -3'

Sequencing Primer
(F):5'- CCAAAAGTTGGCAATCAAATTCAG -3'
(R):5'- GGCACCTGGAATTCATATTCTGATGC -3'
Posted On2016-09-06