Incidental Mutation 'R5400:Cd19'
ID429938
Institutional Source Beutler Lab
Gene Symbol Cd19
Ensembl Gene ENSMUSG00000030724
Gene NameCD19 antigen
SynonymsAW495831
MMRRC Submission 042971-MU
Accession Numbers

Ncbi Ref Seq: NM_009844.2; MGI: 88319

Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126408450-126414889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126414452 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 55 (G55D)
Ref Sequence ENSEMBL: ENSMUSP00000145803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032968] [ENSMUST00000206325]
Predicted Effect probably benign
Transcript: ENSMUST00000032968
AA Change: G55D

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032968
Gene: ENSMUSG00000030724
AA Change: G55D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 23 116 9.12e-7 SMART
low complexity region 139 150 N/A INTRINSIC
IG 182 273 2.41e-6 SMART
transmembrane domain 288 310 N/A INTRINSIC
low complexity region 390 415 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205997
Predicted Effect probably benign
Transcript: ENSMUST00000206325
AA Change: G55D

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206871
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lymphocytes proliferate and differentiate in response to various concentrations of different antigens. The ability of the B cell to respond in a specific, yet sensitive manner to the various antigens is achieved with the use of low-affinity antigen receptors. This gene encodes a cell surface molecule which assembles with the antigen receptor of B lymphocytes in order to decrease the threshold for antigen receptor-dependent stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal B lymphocyte development, activation and differentiation, altered mast cell activation in a model for acute septic peritonitis, inhibition of bleomycin-induced fibrosis and autoantibody production, and increased susceptibility to EAE. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Cd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01896:Cd19 APN 7 126414350 missense possibly damaging 0.74
IGL02243:Cd19 APN 7 126410793 splice site probably null
IGL02465:Cd19 APN 7 126413558 missense possibly damaging 0.65
IGL02824:Cd19 APN 7 126410654 missense probably damaging 0.96
IGL03164:Cd19 APN 7 126413509 missense possibly damaging 0.95
Hexagonal UTSW 7 126414306 nonsense probably null
Hive UTSW 7 126412109 missense probably damaging 1.00
R0076_Cd19_555 UTSW 7 126410862 missense probably damaging 1.00
R0076:Cd19 UTSW 7 126410862 missense probably damaging 1.00
R0076:Cd19 UTSW 7 126410862 missense probably damaging 1.00
R1147:Cd19 UTSW 7 126411045 missense possibly damaging 0.60
R1147:Cd19 UTSW 7 126411045 missense possibly damaging 0.60
R1860:Cd19 UTSW 7 126409641 missense probably damaging 1.00
R2309:Cd19 UTSW 7 126414275 missense probably benign 0.01
R4422:Cd19 UTSW 7 126413406 missense probably benign 0.31
R4532:Cd19 UTSW 7 126412109 missense probably damaging 1.00
R4649:Cd19 UTSW 7 126414492 missense probably benign 0.00
R6846:Cd19 UTSW 7 126410853 missense probably benign 0.28
R7027:Cd19 UTSW 7 126410499 missense possibly damaging 0.72
R7226:Cd19 UTSW 7 126414823 missense unknown
R7464:Cd19 UTSW 7 126411803 missense probably damaging 1.00
R7612:Cd19 UTSW 7 126414324 missense possibly damaging 0.87
R7797:Cd19 UTSW 7 126413508 missense probably damaging 1.00
R7869:Cd19 UTSW 7 126410526 missense probably damaging 1.00
R7885:Cd19 UTSW 7 126412131 missense probably benign 0.03
R8151:Cd19 UTSW 7 126414306 nonsense probably null
R8317:Cd19 UTSW 7 126413443 nonsense probably null
R8438:Cd19 UTSW 7 126414343 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTCCTCTGTCCATGGAGAGC -3'
(R):5'- GACCCTTAGAGCTTCCATATGG -3'

Sequencing Primer
(F):5'- CACGTTCACTGTCCAGGCAG -3'
(R):5'- CATATGGTGGACTTCTGGGGTC -3'
Posted On2016-09-06