Mutagenetix > Incidental Mutations

Incidental Mutation 'R5400:Slc9a9'

429943

Institutional Source

Beutler Lab

Gene Symbol

Slc9a9

Ensembl Gene

ENSMUSG00000031129

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 9

Synonyms

5730527A11Rik, Nhe9

MMRRC Submission

042971-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5400 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94669909-95230445 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 94712901 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 155 (F155I)

Ref Sequence

ENSEMBL: ENSMUSP00000033463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033463]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033463
AA Change: F155I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033463
Gene: ENSMUSG00000031129
AA Change: F155I

Domain	Start	End	E-Value	Type
Pfam:Na_H_Exchanger	28	486	2.6e-89	PFAM
low complexity region	594	600	N/A	INTRINSIC
low complexity region	621	635	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162870

Meta Mutation Damage Score

0.8883

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/proton exchanger that is a member of the solute carrier 9 protein family. The encoded protein localizes the to the late recycling endosomes and may play an important role in maintaining cation homeostasis. Mutations in this gene are associated with autism susceptibility 16 and attention-deficit/hyperactivity disorder. [provided by RefSeq, Mar 2012]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	T	5: 9,479,247	N1027Y	probably damaging	Het
Accsl	T	C	2: 93,859,422	D380G	probably damaging	Het
Afm	T	C	5: 90,551,398	L567P	possibly damaging	Het
AI481877	A	G	4: 59,082,432	S399P	possibly damaging	Het
Anks1b	A	T	10: 90,512,824	I785L	probably damaging	Het
Arpc5l	G	A	2: 39,013,735	G79S	probably benign	Het
Arvcf	G	T	16: 18,399,070	R440L	probably benign	Het
Atm	T	C	9: 53,503,018	D924G	probably damaging	Het
Atp8b1	A	T	18: 64,545,989		probably null	Het
Cd19	C	T	7: 126,414,452	G55D	probably benign	Het
Cd34	A	G	1: 194,938,958		probably benign	Het
Cd69	T	A	6: 129,269,991	M88L	probably benign	Het
Ces2h	A	G	8: 105,018,425	E397G	probably benign	Het
Ddx60	T	C	8: 62,010,002	F1306L	possibly damaging	Het
Dennd5b	T	C	6: 149,000,016	E1124G	probably damaging	Het
Dio1	A	T	4: 107,306,988	M44K	probably damaging	Het
En1	A	G	1: 120,603,595	D188G	probably damaging	Het
Epha10	C	T	4: 124,914,121		probably benign	Het
Fam120b	A	T	17: 15,403,126	L455F	possibly damaging	Het
Flt4	AC	ACC	11: 49,651,034		probably null	Het
Gm38394	G	A	1: 133,658,141	T486I	probably damaging	Het
Incenp	A	G	19: 9,877,675		probably null	Het
Kansl3	A	G	1: 36,358,149	V86A	possibly damaging	Het
Klhl7	C	G	5: 24,126,920	F73L	probably damaging	Het
Med28	T	A	5: 45,525,199	V69D	probably damaging	Het
Mknk1	C	A	4: 115,864,552	L98M	probably damaging	Het
Mknk1	T	A	4: 115,864,553	L98Q	probably damaging	Het
Myo3b	T	A	2: 70,105,380	C97S	probably damaging	Het
Neto1	A	G	18: 86,395,908	H9R	possibly damaging	Het
Olfr1230	T	C	2: 89,296,913	D119G	probably damaging	Het
Olfr317	T	C	11: 58,732,320	T282A	possibly damaging	Het
Olfr354	A	T	2: 36,907,821	I292F	probably damaging	Het
Olfr78	G	A	7: 102,742,430	T191I	probably benign	Het
Omd	A	T	13: 49,592,227	E371V	probably benign	Het
Osbpl9	G	T	4: 109,062,300	Y733*	probably null	Het
Pcdh12	A	T	18: 38,268,898	S91R	probably damaging	Het
Pxk	C	A	14: 8,136,911	P144Q	probably benign	Het
Qser1	A	G	2: 104,789,874	S198P	probably damaging	Het
Recql	T	G	6: 142,362,347		probably benign	Het
Reln	T	C	5: 21,979,714	D1601G	probably damaging	Het
Scn10a	T	C	9: 119,609,034	D1922G	probably damaging	Het
Scn11a	T	A	9: 119,769,908	R1185S	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc13a4	A	T	6: 35,301,842	C37*	probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Spef2	T	A	15: 9,614,281	K1193M	probably damaging	Het
Swt1	T	C	1: 151,412,834	T80A	probably benign	Het
Tmc1	A	G	19: 20,804,602	I584T	probably damaging	Het
Tsc22d1	C	A	14: 76,417,054	F324L	probably benign	Het
Usp19	T	C	9: 108,500,193	V1236A	probably damaging	Het
Vmn2r63	T	C	7: 42,928,211	N301S	probably benign	Het
Wrn	C	T	8: 33,294,917	V476I	probably benign	Het
Zbtb25	C	A	12: 76,349,702	E249*	probably null	Het
Zfp54	C	A	17: 21,433,700	T152K	probably benign	Het

Other mutations in Slc9a9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01301:Slc9a9	APN	9	95055459	missense	probably benign	0.03
IGL01394:Slc9a9	APN	9	95123037	missense	probably benign
IGL01434:Slc9a9	APN	9	95019194	missense	possibly damaging	0.49
IGL01715:Slc9a9	APN	9	94960446	missense	probably damaging	1.00
IGL01821:Slc9a9	APN	9	95228950	missense	probably benign
IGL02963:Slc9a9	APN	9	95020714	critical splice donor site	probably null
IGL03211:Slc9a9	APN	9	95137990	splice site	probably benign
ANU18:Slc9a9	UTSW	9	95055459	missense	probably benign	0.03
R0306:Slc9a9	UTSW	9	95137934	missense	probably benign
R0382:Slc9a9	UTSW	9	94685217	missense	probably benign	0.18
R0388:Slc9a9	UTSW	9	94939563	critical splice donor site	probably null
R1509:Slc9a9	UTSW	9	95228958	missense	probably benign
R1785:Slc9a9	UTSW	9	95019193	missense	possibly damaging	0.95
R4018:Slc9a9	UTSW	9	94685163	missense	probably benign	0.03
R4167:Slc9a9	UTSW	9	95228899	missense	probably damaging	0.98
R4170:Slc9a9	UTSW	9	95228899	missense	probably damaging	0.98
R4695:Slc9a9	UTSW	9	94936449	critical splice donor site	probably benign
R5609:Slc9a9	UTSW	9	94809937	missense	probably damaging	1.00
R5684:Slc9a9	UTSW	9	95055508	missense	possibly damaging	0.89
R6015:Slc9a9	UTSW	9	94939549	missense	probably benign	0.29
R6102:Slc9a9	UTSW	9	94936429	missense	probably benign	0.03
R6317:Slc9a9	UTSW	9	94939459	missense	possibly damaging	0.51
R6398:Slc9a9	UTSW	9	94670227	missense	probably benign	0.00
R6476:Slc9a9	UTSW	9	94685138	missense	probably benign	0.00
R6501:Slc9a9	UTSW	9	94936371	missense	probably benign	0.01
R6603:Slc9a9	UTSW	9	94939546	missense	probably damaging	0.98
R6611:Slc9a9	UTSW	9	94939478	missense	probably benign	0.18
R6700:Slc9a9	UTSW	9	94936311	missense	possibly damaging	0.66
R6824:Slc9a9	UTSW	9	95227198	missense	probably damaging	1.00
R6931:Slc9a9	UTSW	9	94670086	missense	possibly damaging	0.73
R6975:Slc9a9	UTSW	9	94960446	missense	probably damaging	1.00
R6987:Slc9a9	UTSW	9	94669990	start gained	probably benign
R7325:Slc9a9	UTSW	9	94712898	missense	probably benign	0.24
R7374:Slc9a9	UTSW	9	95055489	missense	possibly damaging	0.90
R7437:Slc9a9	UTSW	9	95228941	missense	probably benign	0.00
R7614:Slc9a9	UTSW	9	94855739	missense	probably damaging	1.00
R8412:Slc9a9	UTSW	9	95229039	missense	probably damaging	1.00
R8501:Slc9a9	UTSW	9	94855739	missense	probably damaging	1.00
R8514:Slc9a9	UTSW	9	94936365	missense	probably benign	0.01
X0010:Slc9a9	UTSW	9	94685208	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- AGCTGCATCTGTGGGTTATC -3'
(R):5'- TCACAGACACATACTTGGTCC -3'

Sequencing Primer
(F):5'- GCATCTGTGGGTTATCTCTCC -3'
(R):5'- CTTGGTCCAAAGAGTAAGCATC -3'

Posted On

2016-09-06