Mutagenetix > Incidental Mutation

Incidental Mutation 'R5400:Anks1b'

429947

Institutional Source

Beutler Lab

Gene Symbol

Anks1b

Ensembl Gene

ENSMUSG00000058589

Gene Name

ankyrin repeat and sterile alpha motif domain containing 1B

Synonyms

C030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik

MMRRC Submission

042971-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5400 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89873509-90973300 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90512824 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 785 (I785L)

Ref Sequence

ENSEMBL: ENSMUSP00000138539 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099368] [ENSMUST00000182907] [ENSMUST00000182936] [ENSMUST00000183156]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000099368
AA Change: I785L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589
AA Change: I785L

Domain	Start	End	E-Value	Type
low complexity region	21	46	N/A	INTRINSIC
ANK	58	87	1.88e-5	SMART
ANK	91	123	3.13e-2	SMART
ANK	127	156	6.92e-4	SMART
ANK	160	189	3.08e-1	SMART
ANK	193	222	1.43e-5	SMART
ANK	225	254	4.75e-2	SMART
low complexity region	498	513	N/A	INTRINSIC
low complexity region	551	577	N/A	INTRINSIC
low complexity region	659	670	N/A	INTRINSIC
SAM	806	875	2.06e-19	SMART
SAM	880	931	4.44e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182907

SMART Domains

Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

Domain	Start	End	E-Value	Type
low complexity region	21	45	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182936

SMART Domains

Protein: ENSMUSP00000138209
Gene: ENSMUSG00000058589

Domain	Start	End	E-Value	Type
low complexity region	21	46	N/A	INTRINSIC
ANK	58	87	1.88e-5	SMART
ANK	91	123	3.13e-2	SMART
ANK	127	156	6.92e-4	SMART
ANK	160	189	3.08e-1	SMART
ANK	193	222	1.43e-5	SMART
ANK	225	254	5.03e2	SMART
low complexity region	464	479	N/A	INTRINSIC
low complexity region	517	543	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183156
AA Change: I785L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589
AA Change: I785L

Domain	Start	End	E-Value	Type
low complexity region	21	46	N/A	INTRINSIC
ANK	58	87	1.88e-5	SMART
ANK	91	123	3.13e-2	SMART
ANK	127	156	6.92e-4	SMART
ANK	160	189	3.08e-1	SMART
ANK	193	222	1.43e-5	SMART
ANK	225	254	4.75e-2	SMART
low complexity region	498	513	N/A	INTRINSIC
low complexity region	551	577	N/A	INTRINSIC
low complexity region	659	670	N/A	INTRINSIC
SAM	806	875	2.06e-19	SMART
SAM	880	948	5.66e-17	SMART
low complexity region	968	983	N/A	INTRINSIC
PTB	1056	1194	2.94e-38	SMART

Meta Mutation Damage Score

0.0623

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	T	5: 9,479,247	N1027Y	probably damaging	Het
Accsl	T	C	2: 93,859,422	D380G	probably damaging	Het
Afm	T	C	5: 90,551,398	L567P	possibly damaging	Het
AI481877	A	G	4: 59,082,432	S399P	possibly damaging	Het
Arpc5l	G	A	2: 39,013,735	G79S	probably benign	Het
Arvcf	G	T	16: 18,399,070	R440L	probably benign	Het
Atm	T	C	9: 53,503,018	D924G	probably damaging	Het
Atp8b1	A	T	18: 64,545,989		probably null	Het
Cd19	C	T	7: 126,414,452	G55D	probably benign	Het
Cd34	A	G	1: 194,938,958		probably benign	Het
Cd69	T	A	6: 129,269,991	M88L	probably benign	Het
Ces2h	A	G	8: 105,018,425	E397G	probably benign	Het
Ddx60	T	C	8: 62,010,002	F1306L	possibly damaging	Het
Dennd5b	T	C	6: 149,000,016	E1124G	probably damaging	Het
Dio1	A	T	4: 107,306,988	M44K	probably damaging	Het
En1	A	G	1: 120,603,595	D188G	probably damaging	Het
Epha10	C	T	4: 124,914,121		probably benign	Het
Fam120b	A	T	17: 15,403,126	L455F	possibly damaging	Het
Flt4	AC	ACC	11: 49,651,034		probably null	Het
Gm38394	G	A	1: 133,658,141	T486I	probably damaging	Het
Incenp	A	G	19: 9,877,675		probably null	Het
Kansl3	A	G	1: 36,358,149	V86A	possibly damaging	Het
Klhl7	C	G	5: 24,126,920	F73L	probably damaging	Het
Med28	T	A	5: 45,525,199	V69D	probably damaging	Het
Mknk1	C	A	4: 115,864,552	L98M	probably damaging	Het
Mknk1	T	A	4: 115,864,553	L98Q	probably damaging	Het
Myo3b	T	A	2: 70,105,380	C97S	probably damaging	Het
Neto1	A	G	18: 86,395,908	H9R	possibly damaging	Het
Olfr1230	T	C	2: 89,296,913	D119G	probably damaging	Het
Olfr317	T	C	11: 58,732,320	T282A	possibly damaging	Het
Olfr354	A	T	2: 36,907,821	I292F	probably damaging	Het
Olfr78	G	A	7: 102,742,430	T191I	probably benign	Het
Omd	A	T	13: 49,592,227	E371V	probably benign	Het
Osbpl9	G	T	4: 109,062,300	Y733*	probably null	Het
Pcdh12	A	T	18: 38,268,898	S91R	probably damaging	Het
Pxk	C	A	14: 8,136,911	P144Q	probably benign	Het
Qser1	A	G	2: 104,789,874	S198P	probably damaging	Het
Recql	T	G	6: 142,362,347		probably benign	Het
Reln	T	C	5: 21,979,714	D1601G	probably damaging	Het
Scn10a	T	C	9: 119,609,034	D1922G	probably damaging	Het
Scn11a	T	A	9: 119,769,908	R1185S	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc13a4	A	T	6: 35,301,842	C37*	probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc9a9	T	A	9: 94,712,901	F155I	probably damaging	Het
Spef2	T	A	15: 9,614,281	K1193M	probably damaging	Het
Swt1	T	C	1: 151,412,834	T80A	probably benign	Het
Tmc1	A	G	19: 20,804,602	I584T	probably damaging	Het
Tsc22d1	C	A	14: 76,417,054	F324L	probably benign	Het
Usp19	T	C	9: 108,500,193	V1236A	probably damaging	Het
Vmn2r63	T	C	7: 42,928,211	N301S	probably benign	Het
Wrn	C	T	8: 33,294,917	V476I	probably benign	Het
Zbtb25	C	A	12: 76,349,702	E249*	probably null	Het
Zfp54	C	A	17: 21,433,700	T152K	probably benign	Het

Other mutations in Anks1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01669:Anks1b	APN	10	90897238	splice site	probably benign
IGL01890:Anks1b	APN	10	90644527	missense	probably benign	0.15
IGL01966:Anks1b	APN	10	90895132	missense	probably damaging	1.00
IGL02176:Anks1b	APN	10	90042668	missense	probably damaging	0.99
IGL02205:Anks1b	APN	10	90071094	missense	probably benign	0.00
IGL02465:Anks1b	APN	10	90163265	nonsense	probably null
IGL02534:Anks1b	APN	10	90895117	missense	probably benign	0.45
IGL02554:Anks1b	APN	10	90921378	missense	probably damaging	1.00
IGL02820:Anks1b	APN	10	90077059	missense	possibly damaging	0.93
IGL03164:Anks1b	APN	10	90042692	missense	probably damaging	1.00
R0096:Anks1b	UTSW	10	90074062	missense	possibly damaging	0.90
R0482:Anks1b	UTSW	10	90359195	missense	probably benign	0.00
R0542:Anks1b	UTSW	10	90073967	splice site	probably benign
R0848:Anks1b	UTSW	10	90071125	missense	probably damaging	0.99
R1056:Anks1b	UTSW	10	90921429	splice site	probably null
R1398:Anks1b	UTSW	10	90050029	missense	probably damaging	1.00
R1446:Anks1b	UTSW	10	90511073	missense	probably benign	0.00
R1548:Anks1b	UTSW	10	90049985	missense	possibly damaging	0.79
R1551:Anks1b	UTSW	10	90076981	missense	probably benign	0.00
R1607:Anks1b	UTSW	10	90042548	missense	probably damaging	1.00
R1667:Anks1b	UTSW	10	90511184	critical splice donor site	probably null
R1701:Anks1b	UTSW	10	90049954	missense	probably damaging	1.00
R1843:Anks1b	UTSW	10	90512889	critical splice donor site	probably null
R1899:Anks1b	UTSW	10	90260756	missense	probably damaging	1.00
R1957:Anks1b	UTSW	10	90049930	missense	probably damaging	1.00
R2036:Anks1b	UTSW	10	90969853	missense	probably damaging	0.99
R2279:Anks1b	UTSW	10	90050096	missense	probably damaging	1.00
R2280:Anks1b	UTSW	10	90966302	missense	probably damaging	1.00
R2937:Anks1b	UTSW	10	90077066	missense	probably damaging	1.00
R3739:Anks1b	UTSW	10	90033216	missense	probably damaging	1.00
R4061:Anks1b	UTSW	10	90307622	missense	probably damaging	0.98
R4459:Anks1b	UTSW	10	90510844	missense	probably damaging	1.00
R4479:Anks1b	UTSW	10	90049892	missense	probably damaging	1.00
R4510:Anks1b	UTSW	10	90510790	missense	probably benign	0.01
R4511:Anks1b	UTSW	10	90510790	missense	probably benign	0.01
R4780:Anks1b	UTSW	10	89873732	missense	probably damaging	1.00
R4785:Anks1b	UTSW	10	90914750	missense	probably null	0.88
R4790:Anks1b	UTSW	10	90163275	missense	probably damaging	0.99
R5012:Anks1b	UTSW	10	90359137	missense	probably benign	0.06
R5586:Anks1b	UTSW	10	90077064	missense	probably damaging	0.98
R5687:Anks1b	UTSW	10	90914711	missense	probably benign	0.03
R5899:Anks1b	UTSW	10	90923517	splice site	probably null
R5917:Anks1b	UTSW	10	90576941	intron	probably benign
R5999:Anks1b	UTSW	10	90359048	missense	probably damaging	1.00
R6080:Anks1b	UTSW	10	90966349	nonsense	probably null
R6216:Anks1b	UTSW	10	90260756	missense	probably damaging	1.00
R6265:Anks1b	UTSW	10	90941500	missense	probably damaging	1.00
R6298:Anks1b	UTSW	10	90680837	missense	probably damaging	1.00
R6337:Anks1b	UTSW	10	90921296	missense	probably benign	0.27
R6522:Anks1b	UTSW	10	90897327	intron	probably benign
R6843:Anks1b	UTSW	10	90948598	missense	probably damaging	1.00
R6852:Anks1b	UTSW	10	90260654	missense	probably damaging	1.00
R6933:Anks1b	UTSW	10	90069490	missense	probably damaging	1.00
R7114:Anks1b	UTSW	10	90307698	missense	probably damaging	1.00
R7211:Anks1b	UTSW	10	90511070	missense	possibly damaging	0.94
R7241:Anks1b	UTSW	10	90512837	missense	probably damaging	1.00
R7264:Anks1b	UTSW	10	90512870	missense	probably benign	0.08
R7325:Anks1b	UTSW	10	90941432	missense	probably damaging	1.00
R7392:Anks1b	UTSW	10	90680786	missense	possibly damaging	0.47
R7578:Anks1b	UTSW	10	90049927	missense	probably damaging	1.00
R7604:Anks1b	UTSW	10	90260846	splice site	probably null
R7633:Anks1b	UTSW	10	90948584	missense	probably damaging	1.00
R7881:Anks1b	UTSW	10	90967018	missense	probably benign	0.07
R7910:Anks1b	UTSW	10	90680792	missense	probably damaging	1.00
R7941:Anks1b	UTSW	10	90577155	missense	probably damaging	0.98
R8045:Anks1b	UTSW	10	90680860	missense	probably benign
R8146:Anks1b	UTSW	10	90307698	missense	probably damaging	1.00
R8176:Anks1b	UTSW	10	90069491	missense	probably damaging	1.00
R8535:Anks1b	UTSW	10	90948631	missense	probably benign	0.00
R8681:Anks1b	UTSW	10	90050006	missense	probably damaging	0.99
R9300:Anks1b	UTSW	10	90577104	missense	possibly damaging	0.93
R9469:Anks1b	UTSW	10	90897343	missense	possibly damaging	0.58
R9541:Anks1b	UTSW	10	90577085	missense	probably benign	0.02
R9550:Anks1b	UTSW	10	90576498	start codon destroyed	probably null
RF004:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
RF008:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
RF017:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
RF018:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
RF023:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
X0064:Anks1b	UTSW	10	90512845	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTTGACACTGAACCTGTCC -3'
(R):5'- GAAGGAAATCATTTGCAGCTACTC -3'

Sequencing Primer
(F):5'- CCTAAGTTAATGGGTCACATATGC -3'
(R):5'- TGCAGCTACTCATTATAAAATAGGAC -3'

Posted On

2016-09-06