Incidental Mutation 'R5400:Olfr317'
ID429949
Institutional Source Beutler Lab
Gene Symbol Olfr317
Ensembl Gene ENSMUSG00000060030
Gene Nameolfactory receptor 317
SynonymsGA_x6K02T2NKPP-680866-681849, MOR256-47
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58731018-58739212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58732320 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 282 (T282A)
Ref Sequence ENSEMBL: ENSMUSP00000150027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075607] [ENSMUST00000215513] [ENSMUST00000216196]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075607
AA Change: T282A

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075034
Gene: ENSMUSG00000060030
AA Change: T282A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-50 PFAM
Pfam:7tm_1 41 290 5.8e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215513
AA Change: T282A

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216196
AA Change: T282A

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1962 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Olfr317
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02692:Olfr317 APN 11 58732517 missense probably benign 0.07
IGL03330:Olfr317 APN 11 58732919 missense probably damaging 1.00
R0554:Olfr317 UTSW 11 58733039 missense probably damaging 1.00
R1109:Olfr317 UTSW 11 58732916 missense probably benign 0.03
R2012:Olfr317 UTSW 11 58732388 missense possibly damaging 0.60
R2243:Olfr317 UTSW 11 58732445 missense probably damaging 1.00
R2253:Olfr317 UTSW 11 58732995 missense probably benign 0.23
R6551:Olfr317 UTSW 11 58732757 missense probably damaging 0.99
R6944:Olfr317 UTSW 11 58732242 missense possibly damaging 0.93
R7144:Olfr317 UTSW 11 58732745 missense probably damaging 1.00
R7636:Olfr317 UTSW 11 58732447 missense possibly damaging 0.83
R7985:Olfr317 UTSW 11 58732706 missense possibly damaging 0.49
R8201:Olfr317 UTSW 11 58733114 missense probably damaging 1.00
R8374:Olfr317 UTSW 11 58732898 missense probably damaging 0.97
R8692:Olfr317 UTSW 11 58732769 missense probably damaging 1.00
Z1186:Olfr317 UTSW 11 58732374 missense probably benign 0.02
Z1186:Olfr317 UTSW 11 58732649 missense probably benign
Z1186:Olfr317 UTSW 11 58733222 intron probably benign
Z1187:Olfr317 UTSW 11 58732374 missense probably benign 0.02
Z1187:Olfr317 UTSW 11 58732469 missense probably benign 0.04
Z1187:Olfr317 UTSW 11 58732649 missense probably benign
Z1187:Olfr317 UTSW 11 58733222 intron probably benign
Z1188:Olfr317 UTSW 11 58732374 missense probably benign 0.02
Z1188:Olfr317 UTSW 11 58732469 missense probably benign 0.04
Z1188:Olfr317 UTSW 11 58732649 missense probably benign
Z1188:Olfr317 UTSW 11 58733222 intron probably benign
Z1189:Olfr317 UTSW 11 58732649 missense probably benign
Z1189:Olfr317 UTSW 11 58733222 intron probably benign
Z1190:Olfr317 UTSW 11 58732374 missense probably benign 0.02
Z1190:Olfr317 UTSW 11 58732469 missense probably benign 0.04
Z1190:Olfr317 UTSW 11 58732649 missense probably benign
Z1190:Olfr317 UTSW 11 58733222 intron probably benign
Z1191:Olfr317 UTSW 11 58732374 missense probably benign 0.02
Z1191:Olfr317 UTSW 11 58732469 missense probably benign 0.04
Z1191:Olfr317 UTSW 11 58732649 missense probably benign
Z1191:Olfr317 UTSW 11 58733222 intron probably benign
Z1192:Olfr317 UTSW 11 58732374 missense probably benign 0.02
Z1192:Olfr317 UTSW 11 58732469 missense probably benign 0.04
Z1192:Olfr317 UTSW 11 58732649 missense probably benign
Z1192:Olfr317 UTSW 11 58733222 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCGGAACATTTTCTCTGCC -3'
(R):5'- AGAGCGGTGTTGCGAATCAG -3'

Sequencing Primer
(F):5'- CTCATTAGATGTTAGCCTGAGAGCC -3'
(R):5'- TGTTGCGAATCAGCTCAGC -3'
Posted On2016-09-06