Incidental Mutation 'R5400:Pxk'
ID429953
Institutional Source Beutler Lab
Gene Symbol Pxk
Ensembl Gene ENSMUSG00000033885
Gene NamePX domain containing serine/threonine kinase
SynonymsMONaKA, D14Ertd813e, C230080L11Rik
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location8098211-8165117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8136911 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 144 (P144Q)
Ref Sequence ENSEMBL: ENSMUSP00000152987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036682] [ENSMUST00000112689] [ENSMUST00000225653]
Predicted Effect probably benign
Transcript: ENSMUST00000036682
AA Change: P144Q

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035265
Gene: ENSMUSG00000033885
AA Change: P144Q

DomainStartEndE-ValueType
PX 17 122 1.62e-16 SMART
Pfam:Pkinase 183 441 1.1e-9 PFAM
Pfam:Pkinase_Tyr 185 309 2.5e-7 PFAM
low complexity region 483 536 N/A INTRINSIC
Pfam:WH2 549 577 1.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112689
AA Change: P144Q

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108309
Gene: ENSMUSG00000033885
AA Change: P144Q

DomainStartEndE-ValueType
PX 17 122 1.62e-16 SMART
Pfam:Pkinase_Tyr 185 309 3e-7 PFAM
Pfam:Pkinase 185 441 1.4e-10 PFAM
low complexity region 483 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225616
Predicted Effect probably benign
Transcript: ENSMUST00000225653
AA Change: P144Q

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1144 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phox (PX) domain-containing protein which may be involved in synaptic transmission and the ligand-induced internalization and degradation of epidermal growth factors. Variations in this gene may be associated with susceptibility to systemic lupus erythematosus (SLE). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Pxk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Pxk APN 14 8130754 missense probably damaging 1.00
IGL01865:Pxk APN 14 8136923 missense possibly damaging 0.94
IGL03171:Pxk APN 14 8151014 splice site probably benign
PIT4131001:Pxk UTSW 14 8152130 missense probably benign 0.01
R0799:Pxk UTSW 14 8148123 missense probably benign 0.02
R1367:Pxk UTSW 14 8150915 splice site probably null
R1546:Pxk UTSW 14 8164091 missense probably damaging 1.00
R1800:Pxk UTSW 14 8151507 nonsense probably null
R1827:Pxk UTSW 14 8151507 nonsense probably null
R1828:Pxk UTSW 14 8151507 nonsense probably null
R1888:Pxk UTSW 14 8151540 missense probably damaging 1.00
R1888:Pxk UTSW 14 8151540 missense probably damaging 1.00
R1892:Pxk UTSW 14 8151507 nonsense probably null
R1893:Pxk UTSW 14 8151507 nonsense probably null
R3766:Pxk UTSW 14 8136863 splice site probably benign
R4807:Pxk UTSW 14 8144133 missense probably damaging 1.00
R4816:Pxk UTSW 14 8136893 missense probably damaging 1.00
R4833:Pxk UTSW 14 8130653 missense probably damaging 1.00
R4974:Pxk UTSW 14 8140734 missense probably damaging 1.00
R6075:Pxk UTSW 14 8150964 missense probably benign 0.05
R6144:Pxk UTSW 14 8138011 missense probably damaging 0.99
R6211:Pxk UTSW 14 8163952 missense probably damaging 0.96
R6997:Pxk UTSW 14 8122371 missense probably benign 0.29
R7266:Pxk UTSW 14 8146220 missense probably benign 0.00
R7363:Pxk UTSW 14 8152118 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTAGGGTCCAGTTTAAAAGTCTAC -3'
(R):5'- GTCCTGCATGTTACCCACAC -3'

Sequencing Primer
(F):5'- GTCTGTAGACTACAGGGAT -3'
(R):5'- GTCCTCTGACAGAGCTTTAAGCAAG -3'
Posted On2016-09-06