Incidental Mutation 'R5400:Sh3bp5'
ID429954
Institutional Source Beutler Lab
Gene Symbol Sh3bp5
Ensembl Gene ENSMUSG00000021892
Gene NameSH3-domain binding protein 5 (BTK-associated)
SynonymsSab
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31359880-31436078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31377495 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 265 (R265L)
Ref Sequence ENSEMBL: ENSMUSP00000117152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091903] [ENSMUST00000100730] [ENSMUST00000140002]
Predicted Effect probably benign
Transcript: ENSMUST00000091903
AA Change: R265L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089517
Gene: ENSMUSG00000021892
AA Change: R265L

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.2e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100730
AA Change: R263L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098296
Gene: ENSMUSG00000021892
AA Change: R263L

DomainStartEndE-ValueType
Pfam:SH3BP5 60 274 5.5e-95 PFAM
low complexity region 321 333 N/A INTRINSIC
low complexity region 405 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140002
AA Change: R265L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117152
Gene: ENSMUSG00000021892
AA Change: R265L

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.3e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147586
Meta Mutation Damage Score 0.2831 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Sh3bp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Sh3bp5 APN 14 31379390 nonsense probably null
IGL02828:Sh3bp5 APN 14 31434149 splice site probably benign
R1925:Sh3bp5 UTSW 14 31435923 missense probably benign
R2511:Sh3bp5 UTSW 14 31411629 missense probably damaging 1.00
R4798:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R4799:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5303:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5306:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5307:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5308:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5401:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5402:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5421:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5422:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5496:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5498:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5500:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5687:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5688:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5724:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5762:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5765:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5862:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5938:Sh3bp5 UTSW 14 31387834 missense possibly damaging 0.65
R5940:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5941:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R6516:Sh3bp5 UTSW 14 31375672 missense possibly damaging 0.84
R6935:Sh3bp5 UTSW 14 31379516 missense probably damaging 0.96
R7309:Sh3bp5 UTSW 14 31378289 missense probably benign 0.21
R8196:Sh3bp5 UTSW 14 31417442 missense probably benign 0.21
R8224:Sh3bp5 UTSW 14 31377516 missense probably damaging 0.97
R8535:Sh3bp5 UTSW 14 31417418 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCGTCCCACAATACATGAG -3'
(R):5'- GTGTTGTAATCATGTGTCACCCC -3'

Sequencing Primer
(F):5'- CTGCCCAGCGCTCACATTC -3'
(R):5'- ATGTGTCACCCCCTCCATCAG -3'
Posted On2016-09-06