Incidental Mutation 'R5400:Tsc22d1'
ID429955
Institutional Source Beutler Lab
Gene Symbol Tsc22d1
Ensembl Gene ENSMUSG00000022010
Gene NameTSC22 domain family, member 1
SynonymsTSC-22, Tgfb1i4, Egr5
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location76414961-76507765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76417054 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 324 (F324L)
Ref Sequence ENSEMBL: ENSMUSP00000044517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048371] [ENSMUST00000110888] [ENSMUST00000175984] [ENSMUST00000176581] [ENSMUST00000176886] [ENSMUST00000177471]
Predicted Effect probably benign
Transcript: ENSMUST00000048371
AA Change: F324L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044517
Gene: ENSMUSG00000022010
AA Change: F324L

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 461 489 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
low complexity region 537 556 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 673 687 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 933 970 N/A INTRINSIC
Pfam:TSC22 992 1048 7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110888
SMART Domains Protein: ENSMUSP00000106513
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 415 439 N/A INTRINSIC
low complexity region 455 474 N/A INTRINSIC
internal_repeat_1 502 536 8.43e-5 PROSPERO
low complexity region 537 555 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
internal_repeat_1 644 676 8.43e-5 PROSPERO
low complexity region 851 888 N/A INTRINSIC
Pfam:TSC22 910 969 4.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175984
SMART Domains Protein: ENSMUSP00000135307
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 77 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176581
SMART Domains Protein: ENSMUSP00000135789
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 78 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177333
Predicted Effect probably benign
Transcript: ENSMUST00000177471
SMART Domains Protein: ENSMUSP00000134792
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 18 55 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mcie homozygous for a null allele exhibit increased proliferation of bone marrow cells and decreased kidney and heart weights. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Tsc22d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tsc22d1 APN 14 76418917 missense probably damaging 0.99
IGL00515:Tsc22d1 APN 14 76418477 missense probably damaging 0.99
IGL00703:Tsc22d1 APN 14 76504828 missense possibly damaging 0.62
IGL00974:Tsc22d1 APN 14 76506442 missense probably damaging 1.00
IGL01015:Tsc22d1 APN 14 76418741 missense possibly damaging 0.66
IGL01515:Tsc22d1 APN 14 76505299 critical splice donor site probably null
IGL02172:Tsc22d1 APN 14 76417692 missense probably benign 0.04
IGL02307:Tsc22d1 APN 14 76416461 missense probably damaging 0.99
IGL02553:Tsc22d1 APN 14 76417398 missense possibly damaging 0.73
IGL02870:Tsc22d1 APN 14 76417617 missense probably benign 0.42
IGL02989:Tsc22d1 APN 14 76418901 missense probably benign 0.05
IGL03216:Tsc22d1 APN 14 76418637 missense probably benign 0.02
R0127:Tsc22d1 UTSW 14 76418981 missense possibly damaging 0.92
R0416:Tsc22d1 UTSW 14 76505303 splice site probably benign
R0854:Tsc22d1 UTSW 14 76418201 nonsense probably null
R0963:Tsc22d1 UTSW 14 76418599 missense possibly damaging 0.92
R1370:Tsc22d1 UTSW 14 76437664 intron probably benign
R1736:Tsc22d1 UTSW 14 76418357 missense probably benign 0.08
R1751:Tsc22d1 UTSW 14 76418102 missense probably damaging 0.98
R1760:Tsc22d1 UTSW 14 76416948 missense possibly damaging 0.69
R1767:Tsc22d1 UTSW 14 76418102 missense probably damaging 0.98
R2020:Tsc22d1 UTSW 14 76418333 missense probably damaging 1.00
R2209:Tsc22d1 UTSW 14 76418740 missense probably damaging 1.00
R2439:Tsc22d1 UTSW 14 76417267 unclassified probably benign
R2471:Tsc22d1 UTSW 14 76418204 missense probably benign 0.00
R3114:Tsc22d1 UTSW 14 76417337 missense probably damaging 1.00
R3907:Tsc22d1 UTSW 14 76416543 missense probably damaging 0.98
R3973:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3974:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3975:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3976:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R4292:Tsc22d1 UTSW 14 76418880 missense probably benign 0.12
R4612:Tsc22d1 UTSW 14 76419005 missense possibly damaging 0.66
R4806:Tsc22d1 UTSW 14 76416988 splice site probably null
R4980:Tsc22d1 UTSW 14 76418256 missense probably benign 0.02
R5068:Tsc22d1 UTSW 14 76418310 missense probably benign 0.44
R5070:Tsc22d1 UTSW 14 76418310 missense probably benign 0.44
R5239:Tsc22d1 UTSW 14 76418412 missense probably damaging 0.99
R5360:Tsc22d1 UTSW 14 76417267 unclassified probably benign
R5616:Tsc22d1 UTSW 14 76416217 unclassified probably benign
R5726:Tsc22d1 UTSW 14 76505317 nonsense probably null
R5934:Tsc22d1 UTSW 14 76418826 missense possibly damaging 0.87
R6860:Tsc22d1 UTSW 14 76418292 missense possibly damaging 0.73
R6904:Tsc22d1 UTSW 14 76506483 nonsense probably null
R7016:Tsc22d1 UTSW 14 76417542 missense probably damaging 1.00
R7274:Tsc22d1 UTSW 14 76416714 missense probably damaging 0.98
R7482:Tsc22d1 UTSW 14 76418487 missense probably benign 0.10
R7532:Tsc22d1 UTSW 14 76416046 unclassified probably benign
R7536:Tsc22d1 UTSW 14 76504763 missense probably benign 0.00
R7784:Tsc22d1 UTSW 14 76416701 nonsense probably null
R8161:Tsc22d1 UTSW 14 76417020 missense probably benign 0.02
R8405:Tsc22d1 UTSW 14 76418294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGAAACTCTCTACAACTGG -3'
(R):5'- ACTCCCACAGTGATACCTGC -3'

Sequencing Primer
(F):5'- CTCTCTACAACTGGAAGTTCTGATGG -3'
(R):5'- CAGCTGCATTAAGGACACTGTTAGC -3'
Posted On2016-09-06