Incidental Mutation 'R5400:Arvcf'
ID429957
Institutional Source Beutler Lab
Gene Symbol Arvcf
Ensembl Gene ENSMUSG00000000325
Gene Namearmadillo repeat gene deleted in velocardiofacial syndrome
Synonyms
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18348182-18407076 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 18399070 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 440 (R440L)
Ref Sequence ENSEMBL: ENSMUSP00000111273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090103] [ENSMUST00000115610] [ENSMUST00000115612] [ENSMUST00000115613] [ENSMUST00000115614] [ENSMUST00000150253] [ENSMUST00000232025] [ENSMUST00000232241]
Predicted Effect probably benign
Transcript: ENSMUST00000090103
AA Change: R504L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087562
Gene: ENSMUSG00000000325
AA Change: R504L

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115610
AA Change: R440L

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111273
Gene: ENSMUSG00000000325
AA Change: R440L

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
ARM 327 367 4.48e-7 SMART
ARM 370 411 3.31e-10 SMART
Blast:ARM 412 469 1e-20 BLAST
ARM 472 518 2.1e1 SMART
low complexity region 555 563 N/A INTRINSIC
ARM 582 623 9.55e1 SMART
ARM 629 669 4.05e-5 SMART
ARM 720 762 3.03e0 SMART
low complexity region 857 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115612
AA Change: R504L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111275
Gene: ENSMUSG00000000325
AA Change: R504L

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115613
AA Change: R504L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111276
Gene: ENSMUSG00000000325
AA Change: R504L

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115614
AA Change: R504L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111278
Gene: ENSMUSG00000000325
AA Change: R504L

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126183
Predicted Effect probably benign
Transcript: ENSMUST00000150253
AA Change: R440L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231791
Predicted Effect probably benign
Transcript: ENSMUST00000232025
AA Change: R440L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232241
Meta Mutation Damage Score 0.0650 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo Repeat gene deleted in Velo-Cardio-Facial syndrome (ARVCF) is a member of the catenin family. This family plays an important role in the formation of adherens junction complexes, which are thought to facilitate communication between the inside and outside environments of a cell. The ARVCF gene was isolated in the search for the genetic defect responsible for the autosomal dominant Velo-Cardio-Facial syndrome (VCFS), a relatively common human disorder with phenotypic features including cleft palate, conotruncal heart defects and facial dysmorphology. The ARVCF gene encodes a protein containing two motifs, a coiled coil domain in the N-terminus and a 10 armadillo repeat sequence in the midregion. Since these sequences can facilitate protein-protein interactions ARVCF is thought to function in a protein complex. In addition, ARVCF contains a predicted nuclear-targeting sequence suggesting that it may have a function as a nuclear protein. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele display abnormal gait and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Arvcf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Arvcf APN 16 18403900 missense probably damaging 1.00
IGL02901:Arvcf APN 16 18398242 missense probably damaging 0.99
IGL03218:Arvcf APN 16 18404125 splice site probably benign
IGL03239:Arvcf APN 16 18397067 missense probably damaging 1.00
PIT4466001:Arvcf UTSW 16 18402949 missense possibly damaging 0.91
PIT4472001:Arvcf UTSW 16 18402949 missense possibly damaging 0.91
R0045:Arvcf UTSW 16 18403458 missense probably benign 0.40
R0068:Arvcf UTSW 16 18396954 splice site probably benign
R0068:Arvcf UTSW 16 18396954 splice site probably benign
R0873:Arvcf UTSW 16 18400205 nonsense probably null
R1227:Arvcf UTSW 16 18389304 missense probably benign 0.00
R1495:Arvcf UTSW 16 18389386 missense probably damaging 0.96
R1717:Arvcf UTSW 16 18401569 missense possibly damaging 0.52
R2021:Arvcf UTSW 16 18399732 missense probably damaging 1.00
R3873:Arvcf UTSW 16 18403033 missense probably damaging 1.00
R4095:Arvcf UTSW 16 18401577 missense probably damaging 1.00
R4280:Arvcf UTSW 16 18397991 missense probably damaging 1.00
R4496:Arvcf UTSW 16 18405182 missense probably damaging 0.96
R4887:Arvcf UTSW 16 18398113 nonsense probably null
R5068:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5069:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5070:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5322:Arvcf UTSW 16 18397643 missense probably benign 0.00
R6376:Arvcf UTSW 16 18405132 missense probably damaging 0.98
R6771:Arvcf UTSW 16 18403864 missense probably benign
R7106:Arvcf UTSW 16 18399049 missense probably damaging 0.99
R7176:Arvcf UTSW 16 18399727 missense probably damaging 1.00
R7202:Arvcf UTSW 16 18405198 missense probably damaging 1.00
R7412:Arvcf UTSW 16 18401600 missense probably benign 0.03
R7737:Arvcf UTSW 16 18397101 missense probably damaging 1.00
R7783:Arvcf UTSW 16 18389198 missense probably benign 0.30
Z1088:Arvcf UTSW 16 18402641 missense probably damaging 1.00
Z1177:Arvcf UTSW 16 18389299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTATGCTGGGTTCAGGTGC -3'
(R):5'- GGCTCAGGAATGCCTAAACTTTG -3'

Sequencing Primer
(F):5'- CAGAAGCAGATTGTGTCATCCCTG -3'
(R):5'- TGCCTAAACTTTGAACAAGCTGGG -3'
Posted On2016-09-06