Incidental Mutation 'R5400:Fam120b'
ID429958
Institutional Source Beutler Lab
Gene Symbol Fam120b
Ensembl Gene ENSMUSG00000014763
Gene Namefamily with sequence similarity 120, member B
SynonymsCCPG, 4932442K08Rik
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15396202-15433583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15403126 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 455 (L455F)
Ref Sequence ENSEMBL: ENSMUSP00000054420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055352]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055352
AA Change: L455F

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054420
Gene: ENSMUSG00000014763
AA Change: L455F

DomainStartEndE-ValueType
Blast:XPGN 1 111 7e-46 BLAST
SCOP:d1a77_2 21 185 6e-8 SMART
internal_repeat_1 324 364 9.23e-10 PROSPERO
internal_repeat_1 372 412 9.23e-10 PROSPERO
low complexity region 650 664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231318
Meta Mutation Damage Score 0.1924 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Fam120b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam120b APN 17 15402595 nonsense probably null
IGL01874:Fam120b APN 17 15403039 nonsense probably null
IGL02111:Fam120b APN 17 15402585 missense possibly damaging 0.67
IGL02395:Fam120b APN 17 15402515 missense probably damaging 1.00
IGL02901:Fam120b APN 17 15407702 splice site probably benign
IGL03380:Fam120b APN 17 15403134 splice site probably benign
R0139:Fam120b UTSW 17 15426184 splice site probably benign
R0242:Fam120b UTSW 17 15422924 missense probably damaging 1.00
R0242:Fam120b UTSW 17 15422924 missense probably damaging 1.00
R0244:Fam120b UTSW 17 15417637 missense probably damaging 1.00
R0486:Fam120b UTSW 17 15426288 splice site probably benign
R0551:Fam120b UTSW 17 15431643 splice site probably benign
R0584:Fam120b UTSW 17 15402122 missense probably damaging 1.00
R0620:Fam120b UTSW 17 15402927 missense probably benign
R1606:Fam120b UTSW 17 15401811 missense possibly damaging 0.79
R1638:Fam120b UTSW 17 15402497 missense possibly damaging 0.95
R2022:Fam120b UTSW 17 15424376 missense possibly damaging 0.70
R3411:Fam120b UTSW 17 15431635 splice site probably benign
R4422:Fam120b UTSW 17 15402183 missense probably damaging 1.00
R4754:Fam120b UTSW 17 15422962 missense probably damaging 1.00
R4756:Fam120b UTSW 17 15402396 missense probably damaging 1.00
R4883:Fam120b UTSW 17 15403032 missense probably benign
R5418:Fam120b UTSW 17 15401799 missense probably damaging 1.00
R5632:Fam120b UTSW 17 15403082 missense probably benign 0.08
R5878:Fam120b UTSW 17 15402240 missense probably damaging 1.00
R6030:Fam120b UTSW 17 15401910 missense probably damaging 1.00
R6030:Fam120b UTSW 17 15401910 missense probably damaging 1.00
R6846:Fam120b UTSW 17 15414829 missense probably damaging 1.00
R6929:Fam120b UTSW 17 15423028 missense possibly damaging 0.78
R7356:Fam120b UTSW 17 15407696 missense probably benign 0.05
R7616:Fam120b UTSW 17 15402836 missense possibly damaging 0.79
R7848:Fam120b UTSW 17 15405774 missense possibly damaging 0.93
R7931:Fam120b UTSW 17 15405774 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACAAGAAGTTCCCATGTGCAC -3'
(R):5'- TCCCATCCTATTCACAAGGCAG -3'

Sequencing Primer
(F):5'- GAAGTTCCCATGTGCACAGACTC -3'
(R):5'- TTCACAAGGCAGTATCAGATGTACC -3'
Posted On2016-09-06