Incidental Mutation 'R5400:Zfp54'
ID429959
Institutional Source Beutler Lab
Gene Symbol Zfp54
Ensembl Gene ENSMUSG00000023882
Gene Namezinc finger protein 54
SynonymsKRAB10, Zfp-54, Zfp76, clone 18
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21423227-21435640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21433700 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 152 (T152K)
Ref Sequence ENSEMBL: ENSMUSP00000132983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007884] [ENSMUST00000165230] [ENSMUST00000167749]
Predicted Effect probably benign
Transcript: ENSMUST00000007884
AA Change: T152K

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000007884
Gene: ENSMUSG00000023882
AA Change: T152K

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 2.12e-4 SMART
ZnF_C2H2 299 321 6.67e-2 SMART
ZnF_C2H2 327 349 7.67e-2 SMART
ZnF_C2H2 355 377 2.71e-2 SMART
ZnF_C2H2 383 403 6.24e0 SMART
ZnF_C2H2 411 433 5.99e-4 SMART
ZnF_C2H2 439 461 1.69e-3 SMART
ZnF_C2H2 467 489 2.43e-4 SMART
ZnF_C2H2 495 517 2.3e-5 SMART
ZnF_C2H2 523 545 8.22e-2 SMART
ZnF_C2H2 551 573 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165230
AA Change: T152K

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000132983
Gene: ENSMUSG00000023882
AA Change: T152K

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 2.12e-4 SMART
ZnF_C2H2 299 321 6.67e-2 SMART
ZnF_C2H2 327 349 7.67e-2 SMART
ZnF_C2H2 355 377 2.71e-2 SMART
ZnF_C2H2 383 403 6.24e0 SMART
ZnF_C2H2 411 433 5.99e-4 SMART
ZnF_C2H2 439 461 1.69e-3 SMART
ZnF_C2H2 467 489 2.43e-4 SMART
ZnF_C2H2 495 517 2.3e-5 SMART
ZnF_C2H2 523 545 8.22e-2 SMART
ZnF_C2H2 551 573 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167749
AA Change: T152K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127089
Gene: ENSMUSG00000023882
AA Change: T152K

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232563
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Other mutations in Zfp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Zfp54 APN 17 21433559 missense possibly damaging 0.62
IGL00425:Zfp54 APN 17 21430297 missense probably damaging 1.00
IGL02830:Zfp54 APN 17 21433456 missense probably damaging 1.00
IGL03037:Zfp54 APN 17 21430215 missense probably damaging 0.99
R1853:Zfp54 UTSW 17 21434142 nonsense probably null
R1855:Zfp54 UTSW 17 21434142 nonsense probably null
R1915:Zfp54 UTSW 17 21434152 missense probably benign
R3803:Zfp54 UTSW 17 21433552 missense possibly damaging 0.58
R4430:Zfp54 UTSW 17 21434960 missense probably damaging 0.98
R4724:Zfp54 UTSW 17 21433403 missense probably damaging 0.96
R4799:Zfp54 UTSW 17 21434140 missense probably damaging 1.00
R5197:Zfp54 UTSW 17 21434180 missense probably benign 0.12
R5422:Zfp54 UTSW 17 21434526 missense probably benign 0.00
R5566:Zfp54 UTSW 17 21433444 missense probably damaging 0.99
R6460:Zfp54 UTSW 17 21433742 missense probably benign
R6528:Zfp54 UTSW 17 21433474 nonsense probably null
R6876:Zfp54 UTSW 17 21433977 missense probably damaging 1.00
R7296:Zfp54 UTSW 17 21433582 missense probably benign 0.11
R7342:Zfp54 UTSW 17 21427752 start gained probably benign
R7660:Zfp54 UTSW 17 21434239 missense probably damaging 1.00
R7701:Zfp54 UTSW 17 21434095 missense probably benign 0.02
R7796:Zfp54 UTSW 17 21434720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTTTATAATAGAAGCGACAC -3'
(R):5'- GCACTCAGTAAAGGATTTGTCAC -3'

Sequencing Primer
(F):5'- CCTTTATAATAGAAGCGACACTACAG -3'
(R):5'- GTCACAAATATTGCACTTGTAGGG -3'
Posted On2016-09-06