Incidental Mutation 'R5400:Pcdh12'
ID429960
Institutional Source Beutler Lab
Gene Symbol Pcdh12
Ensembl Gene ENSMUSG00000024440
Gene Nameprotocadherin 12
SynonymsVE-cadherin-2, vascular endothelial cadherin-2
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location38267092-38284402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38268898 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 91 (S91R)
Ref Sequence ENSEMBL: ENSMUSP00000141907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]
Predicted Effect probably damaging
Transcript: ENSMUST00000025311
AA Change: S1150R

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: S1150R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 53 133 4.42e-2 SMART
CA 157 242 2.55e-17 SMART
CA 266 350 2.31e-24 SMART
CA 376 458 3.86e-26 SMART
CA 482 563 6.27e-26 SMART
CA 621 704 3.02e-2 SMART
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 960 975 N/A INTRINSIC
low complexity region 1032 1041 N/A INTRINSIC
low complexity region 1115 1125 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194012
AA Change: S91R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440
AA Change: S91R

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195747
Meta Mutation Damage Score 0.1277 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Pcdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcdh12 APN 18 38281457 missense probably benign
IGL00964:Pcdh12 APN 18 38282731 missense probably benign 0.27
IGL01105:Pcdh12 APN 18 38275347 missense probably damaging 1.00
IGL02011:Pcdh12 APN 18 38281420 missense probably damaging 1.00
IGL02234:Pcdh12 APN 18 38283535 missense probably damaging 1.00
IGL02452:Pcdh12 APN 18 38281693 missense probably benign 0.00
IGL03412:Pcdh12 APN 18 38283515 missense probably benign 0.24
R0729:Pcdh12 UTSW 18 38282464 missense probably benign 0.20
R1330:Pcdh12 UTSW 18 38281861 missense probably benign 0.13
R1394:Pcdh12 UTSW 18 38281189 critical splice donor site probably null
R1413:Pcdh12 UTSW 18 38283443 missense probably damaging 1.00
R1993:Pcdh12 UTSW 18 38282143 missense possibly damaging 0.62
R2115:Pcdh12 UTSW 18 38283986 missense probably damaging 1.00
R2567:Pcdh12 UTSW 18 38282096 missense probably damaging 1.00
R2926:Pcdh12 UTSW 18 38282390 missense probably damaging 0.99
R3810:Pcdh12 UTSW 18 38281237 missense probably damaging 1.00
R3813:Pcdh12 UTSW 18 38283614 nonsense probably null
R5275:Pcdh12 UTSW 18 38284101 utr 5 prime probably benign
R5523:Pcdh12 UTSW 18 38283139 missense probably damaging 1.00
R5539:Pcdh12 UTSW 18 38281744 missense possibly damaging 0.77
R5604:Pcdh12 UTSW 18 38268882 missense probably damaging 1.00
R6012:Pcdh12 UTSW 18 38283752 missense probably damaging 1.00
R6042:Pcdh12 UTSW 18 38281505 missense probably damaging 1.00
R6129:Pcdh12 UTSW 18 38277859 missense probably damaging 1.00
R6239:Pcdh12 UTSW 18 38282401 missense probably damaging 1.00
R6508:Pcdh12 UTSW 18 38281337 nonsense probably null
R7250:Pcdh12 UTSW 18 38281976 missense probably benign
R7259:Pcdh12 UTSW 18 38281624 missense probably benign 0.00
R7271:Pcdh12 UTSW 18 38283047 missense probably damaging 1.00
R7489:Pcdh12 UTSW 18 38281789 missense possibly damaging 0.77
Z1177:Pcdh12 UTSW 18 38282992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAGCTTATTCCCTGAGATCC -3'
(R):5'- CTACAACGTCAGAGGAACCG -3'

Sequencing Primer
(F):5'- TGAGATCCTCAAGACCCGAGTG -3'
(R):5'- CCAGACATTCGGCAAGACAGTTG -3'
Posted On2016-09-06