Mutagenetix > Incidental Mutations

Incidental Mutation 'R5400:Pcdh12'

429960

Institutional Source

Beutler Lab

Gene Symbol

Pcdh12

Ensembl Gene

ENSMUSG00000024440

Gene Name

protocadherin 12

Synonyms

VE-cadherin-2, vascular endothelial cadherin-2

MMRRC Submission

042971-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5400 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38267092-38284402 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 38268898 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 91 (S91R)

Ref Sequence

ENSEMBL: ENSMUSP00000141907 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025311
AA Change: S1150R

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: S1150R

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
CA	53	133	4.42e-2	SMART
CA	157	242	2.55e-17	SMART
CA	266	350	2.31e-24	SMART
CA	376	458	3.86e-26	SMART
CA	482	563	6.27e-26	SMART
CA	621	704	3.02e-2	SMART
transmembrane domain	716	738	N/A	INTRINSIC
low complexity region	960	975	N/A	INTRINSIC
low complexity region	1032	1041	N/A	INTRINSIC
low complexity region	1115	1125	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000194012
AA Change: S91R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440
AA Change: S91R

Domain	Start	End	E-Value	Type
low complexity region	56	66	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195747

Meta Mutation Damage Score

0.1277

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	T	5: 9,479,247	N1027Y	probably damaging	Het
Accsl	T	C	2: 93,859,422	D380G	probably damaging	Het
Afm	T	C	5: 90,551,398	L567P	possibly damaging	Het
AI481877	A	G	4: 59,082,432	S399P	possibly damaging	Het
Anks1b	A	T	10: 90,512,824	I785L	probably damaging	Het
Arpc5l	G	A	2: 39,013,735	G79S	probably benign	Het
Arvcf	G	T	16: 18,399,070	R440L	probably benign	Het
Atm	T	C	9: 53,503,018	D924G	probably damaging	Het
Atp8b1	A	T	18: 64,545,989		probably null	Het
Cd19	C	T	7: 126,414,452	G55D	probably benign	Het
Cd34	A	G	1: 194,938,958		probably benign	Het
Cd69	T	A	6: 129,269,991	M88L	probably benign	Het
Ces2h	A	G	8: 105,018,425	E397G	probably benign	Het
Ddx60	T	C	8: 62,010,002	F1306L	possibly damaging	Het
Dennd5b	T	C	6: 149,000,016	E1124G	probably damaging	Het
Dio1	A	T	4: 107,306,988	M44K	probably damaging	Het
En1	A	G	1: 120,603,595	D188G	probably damaging	Het
Epha10	C	T	4: 124,914,121		probably benign	Het
Fam120b	A	T	17: 15,403,126	L455F	possibly damaging	Het
Flt4	AC	ACC	11: 49,651,034		probably null	Het
Gm38394	G	A	1: 133,658,141	T486I	probably damaging	Het
Incenp	A	G	19: 9,877,675		probably null	Het
Kansl3	A	G	1: 36,358,149	V86A	possibly damaging	Het
Klhl7	C	G	5: 24,126,920	F73L	probably damaging	Het
Med28	T	A	5: 45,525,199	V69D	probably damaging	Het
Mknk1	C	A	4: 115,864,552	L98M	probably damaging	Het
Mknk1	T	A	4: 115,864,553	L98Q	probably damaging	Het
Myo3b	T	A	2: 70,105,380	C97S	probably damaging	Het
Neto1	A	G	18: 86,395,908	H9R	possibly damaging	Het
Olfr1230	T	C	2: 89,296,913	D119G	probably damaging	Het
Olfr317	T	C	11: 58,732,320	T282A	possibly damaging	Het
Olfr354	A	T	2: 36,907,821	I292F	probably damaging	Het
Olfr78	G	A	7: 102,742,430	T191I	probably benign	Het
Omd	A	T	13: 49,592,227	E371V	probably benign	Het
Osbpl9	G	T	4: 109,062,300	Y733*	probably null	Het
Pxk	C	A	14: 8,136,911	P144Q	probably benign	Het
Qser1	A	G	2: 104,789,874	S198P	probably damaging	Het
Recql	T	G	6: 142,362,347		probably benign	Het
Reln	T	C	5: 21,979,714	D1601G	probably damaging	Het
Scn10a	T	C	9: 119,609,034	D1922G	probably damaging	Het
Scn11a	T	A	9: 119,769,908	R1185S	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc13a4	A	T	6: 35,301,842	C37*	probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc9a9	T	A	9: 94,712,901	F155I	probably damaging	Het
Spef2	T	A	15: 9,614,281	K1193M	probably damaging	Het
Swt1	T	C	1: 151,412,834	T80A	probably benign	Het
Tmc1	A	G	19: 20,804,602	I584T	probably damaging	Het
Tsc22d1	C	A	14: 76,417,054	F324L	probably benign	Het
Usp19	T	C	9: 108,500,193	V1236A	probably damaging	Het
Vmn2r63	T	C	7: 42,928,211	N301S	probably benign	Het
Wrn	C	T	8: 33,294,917	V476I	probably benign	Het
Zbtb25	C	A	12: 76,349,702	E249*	probably null	Het
Zfp54	C	A	17: 21,433,700	T152K	probably benign	Het

Other mutations in Pcdh12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Pcdh12	APN	18	38281457	missense	probably benign
IGL00964:Pcdh12	APN	18	38282731	missense	probably benign	0.27
IGL01105:Pcdh12	APN	18	38275347	missense	probably damaging	1.00
IGL02011:Pcdh12	APN	18	38281420	missense	probably damaging	1.00
IGL02234:Pcdh12	APN	18	38283535	missense	probably damaging	1.00
IGL02452:Pcdh12	APN	18	38281693	missense	probably benign	0.00
IGL03412:Pcdh12	APN	18	38283515	missense	probably benign	0.24
R0729:Pcdh12	UTSW	18	38282464	missense	probably benign	0.20
R1330:Pcdh12	UTSW	18	38281861	missense	probably benign	0.13
R1394:Pcdh12	UTSW	18	38281189	critical splice donor site	probably null
R1413:Pcdh12	UTSW	18	38283443	missense	probably damaging	1.00
R1993:Pcdh12	UTSW	18	38282143	missense	possibly damaging	0.62
R2115:Pcdh12	UTSW	18	38283986	missense	probably damaging	1.00
R2567:Pcdh12	UTSW	18	38282096	missense	probably damaging	1.00
R2926:Pcdh12	UTSW	18	38282390	missense	probably damaging	0.99
R3810:Pcdh12	UTSW	18	38281237	missense	probably damaging	1.00
R3813:Pcdh12	UTSW	18	38283614	nonsense	probably null
R5275:Pcdh12	UTSW	18	38284101	utr 5 prime	probably benign
R5523:Pcdh12	UTSW	18	38283139	missense	probably damaging	1.00
R5539:Pcdh12	UTSW	18	38281744	missense	possibly damaging	0.77
R5604:Pcdh12	UTSW	18	38268882	missense	probably damaging	1.00
R6012:Pcdh12	UTSW	18	38283752	missense	probably damaging	1.00
R6042:Pcdh12	UTSW	18	38281505	missense	probably damaging	1.00
R6129:Pcdh12	UTSW	18	38277859	missense	probably damaging	1.00
R6239:Pcdh12	UTSW	18	38282401	missense	probably damaging	1.00
R6508:Pcdh12	UTSW	18	38281337	nonsense	probably null
R7250:Pcdh12	UTSW	18	38281976	missense	probably benign
R7259:Pcdh12	UTSW	18	38281624	missense	probably benign	0.00
R7271:Pcdh12	UTSW	18	38283047	missense	probably damaging	1.00
R7489:Pcdh12	UTSW	18	38281789	missense	possibly damaging	0.77
Z1177:Pcdh12	UTSW	18	38282992	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACCAGCTTATTCCCTGAGATCC -3'
(R):5'- CTACAACGTCAGAGGAACCG -3'

Sequencing Primer
(F):5'- TGAGATCCTCAAGACCCGAGTG -3'
(R):5'- CCAGACATTCGGCAAGACAGTTG -3'

Posted On

2016-09-06