Mutagenetix > Incidental Mutations

Incidental Mutation 'R5400:Atp8b1'

429961

Institutional Source

Beutler Lab

Gene Symbol

Atp8b1

Ensembl Gene

ENSMUSG00000039529

Gene Name

ATPase, class I, type 8B, member 1

Synonyms

FIC1, Ic

MMRRC Submission

042971-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5400 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64528979-64661000 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 64545989 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000025482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025482]

AlphaFold

Q148W0

Predicted Effect

probably null
Transcript: ENSMUST00000025482

SMART Domains

Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	65	144	5.3e-29	PFAM
Pfam:E1-E2_ATPase	146	413	6e-11	PFAM
Pfam:HAD	451	902	2.4e-21	PFAM
Pfam:Cation_ATPase	532	632	1e-12	PFAM
Pfam:PhoLip_ATPase_C	919	1173	7.3e-82	PFAM
low complexity region	1193	1207	N/A	INTRINSIC
low complexity region	1221	1232	N/A	INTRINSIC

Meta Mutation Damage Score

0.9493

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	T	5: 9,479,247	N1027Y	probably damaging	Het
Accsl	T	C	2: 93,859,422	D380G	probably damaging	Het
Afm	T	C	5: 90,551,398	L567P	possibly damaging	Het
AI481877	A	G	4: 59,082,432	S399P	possibly damaging	Het
Anks1b	A	T	10: 90,512,824	I785L	probably damaging	Het
Arpc5l	G	A	2: 39,013,735	G79S	probably benign	Het
Arvcf	G	T	16: 18,399,070	R440L	probably benign	Het
Atm	T	C	9: 53,503,018	D924G	probably damaging	Het
Cd19	C	T	7: 126,414,452	G55D	probably benign	Het
Cd34	A	G	1: 194,938,958		probably benign	Het
Cd69	T	A	6: 129,269,991	M88L	probably benign	Het
Ces2h	A	G	8: 105,018,425	E397G	probably benign	Het
Ddx60	T	C	8: 62,010,002	F1306L	possibly damaging	Het
Dennd5b	T	C	6: 149,000,016	E1124G	probably damaging	Het
Dio1	A	T	4: 107,306,988	M44K	probably damaging	Het
En1	A	G	1: 120,603,595	D188G	probably damaging	Het
Epha10	C	T	4: 124,914,121		probably benign	Het
Fam120b	A	T	17: 15,403,126	L455F	possibly damaging	Het
Flt4	AC	ACC	11: 49,651,034		probably null	Het
Gm38394	G	A	1: 133,658,141	T486I	probably damaging	Het
Incenp	A	G	19: 9,877,675		probably null	Het
Kansl3	A	G	1: 36,358,149	V86A	possibly damaging	Het
Klhl7	C	G	5: 24,126,920	F73L	probably damaging	Het
Med28	T	A	5: 45,525,199	V69D	probably damaging	Het
Mknk1	C	A	4: 115,864,552	L98M	probably damaging	Het
Mknk1	T	A	4: 115,864,553	L98Q	probably damaging	Het
Myo3b	T	A	2: 70,105,380	C97S	probably damaging	Het
Neto1	A	G	18: 86,395,908	H9R	possibly damaging	Het
Olfr1230	T	C	2: 89,296,913	D119G	probably damaging	Het
Olfr317	T	C	11: 58,732,320	T282A	possibly damaging	Het
Olfr354	A	T	2: 36,907,821	I292F	probably damaging	Het
Olfr78	G	A	7: 102,742,430	T191I	probably benign	Het
Omd	A	T	13: 49,592,227	E371V	probably benign	Het
Osbpl9	G	T	4: 109,062,300	Y733*	probably null	Het
Pcdh12	A	T	18: 38,268,898	S91R	probably damaging	Het
Pxk	C	A	14: 8,136,911	P144Q	probably benign	Het
Qser1	A	G	2: 104,789,874	S198P	probably damaging	Het
Recql	T	G	6: 142,362,347		probably benign	Het
Reln	T	C	5: 21,979,714	D1601G	probably damaging	Het
Scn10a	T	C	9: 119,609,034	D1922G	probably damaging	Het
Scn11a	T	A	9: 119,769,908	R1185S	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc13a4	A	T	6: 35,301,842	C37*	probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc9a9	T	A	9: 94,712,901	F155I	probably damaging	Het
Spef2	T	A	15: 9,614,281	K1193M	probably damaging	Het
Swt1	T	C	1: 151,412,834	T80A	probably benign	Het
Tmc1	A	G	19: 20,804,602	I584T	probably damaging	Het
Tsc22d1	C	A	14: 76,417,054	F324L	probably benign	Het
Usp19	T	C	9: 108,500,193	V1236A	probably damaging	Het
Vmn2r63	T	C	7: 42,928,211	N301S	probably benign	Het
Wrn	C	T	8: 33,294,917	V476I	probably benign	Het
Zbtb25	C	A	12: 76,349,702	E249*	probably null	Het
Zfp54	C	A	17: 21,433,700	T152K	probably benign	Het

Other mutations in Atp8b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Atp8b1	APN	18	64564430	missense	probably benign	0.23
IGL00907:Atp8b1	APN	18	64561705	missense	possibly damaging	0.95
IGL00962:Atp8b1	APN	18	64531444	missense	probably damaging	1.00
IGL01433:Atp8b1	APN	18	64573519	missense	probably benign	0.00
IGL01525:Atp8b1	APN	18	64539252	nonsense	probably null
IGL01645:Atp8b1	APN	18	64546113	missense	probably benign	0.06
IGL02008:Atp8b1	APN	18	64538695	splice site	probably benign
IGL02227:Atp8b1	APN	18	64562190	missense	probably benign
IGL02231:Atp8b1	APN	18	64550384	missense	possibly damaging	0.94
IGL02326:Atp8b1	APN	18	64538583	missense	probably damaging	0.99
IGL02562:Atp8b1	APN	18	64581986	missense	probably benign
IGL02929:Atp8b1	APN	18	64561662	missense	possibly damaging	0.63
enchilada	UTSW	18	64545989	critical splice donor site	probably null
PIT4520001:Atp8b1	UTSW	18	64568180	missense	probably benign	0.34
PIT4696001:Atp8b1	UTSW	18	64539270	missense	possibly damaging	0.93
R0144:Atp8b1	UTSW	18	64571374	splice site	probably benign
R0193:Atp8b1	UTSW	18	64561636	missense	probably benign
R0277:Atp8b1	UTSW	18	64568252	missense	possibly damaging	0.94
R0308:Atp8b1	UTSW	18	64545244	nonsense	probably null
R0323:Atp8b1	UTSW	18	64568252	missense	possibly damaging	0.94
R0403:Atp8b1	UTSW	18	64540310	missense	probably damaging	1.00
R0601:Atp8b1	UTSW	18	64571653	splice site	probably null
R0614:Atp8b1	UTSW	18	64533587	splice site	probably benign
R0883:Atp8b1	UTSW	18	64564541	missense	probably benign	0.44
R1077:Atp8b1	UTSW	18	64573262	nonsense	probably null
R1292:Atp8b1	UTSW	18	64571021	missense	probably damaging	0.99
R1494:Atp8b1	UTSW	18	64564526	missense	probably damaging	1.00
R1522:Atp8b1	UTSW	18	64550432	missense	probably benign	0.00
R1534:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1535:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1536:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1537:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1650:Atp8b1	UTSW	18	64571549	splice site	probably benign
R1772:Atp8b1	UTSW	18	64573492	missense	possibly damaging	0.88
R2016:Atp8b1	UTSW	18	64540334	missense	probably damaging	1.00
R2017:Atp8b1	UTSW	18	64540334	missense	probably damaging	1.00
R2043:Atp8b1	UTSW	18	64605200	missense	possibly damaging	0.94
R2223:Atp8b1	UTSW	18	64564357	missense	possibly damaging	0.88
R3052:Atp8b1	UTSW	18	64553108	missense	probably benign	0.04
R3694:Atp8b1	UTSW	18	64533721	missense	possibly damaging	0.81
R3738:Atp8b1	UTSW	18	64533729	splice site	probably benign
R4211:Atp8b1	UTSW	18	64553047	missense	probably damaging	1.00
R4362:Atp8b1	UTSW	18	64564537	missense	probably damaging	1.00
R4560:Atp8b1	UTSW	18	64556879	nonsense	probably null
R4560:Atp8b1	UTSW	18	64568247	missense	probably benign	0.11
R4562:Atp8b1	UTSW	18	64556891	missense	probably damaging	1.00
R4615:Atp8b1	UTSW	18	64553099	missense	probably null
R4676:Atp8b1	UTSW	18	64538678	missense	probably benign	0.01
R4738:Atp8b1	UTSW	18	64545180	missense	probably benign	0.31
R4774:Atp8b1	UTSW	18	64533659	missense	possibly damaging	0.49
R4808:Atp8b1	UTSW	18	64561711	missense	probably benign	0.01
R4868:Atp8b1	UTSW	18	64551866	missense	probably damaging	1.00
R5162:Atp8b1	UTSW	18	64561662	missense	possibly damaging	0.63
R5289:Atp8b1	UTSW	18	64546087	missense	possibly damaging	0.51
R5328:Atp8b1	UTSW	18	64531391	missense	probably benign	0.00
R5587:Atp8b1	UTSW	18	64539210	missense	probably damaging	1.00
R5623:Atp8b1	UTSW	18	64546094	missense	possibly damaging	0.85
R5651:Atp8b1	UTSW	18	64531382	missense	probably benign	0.31
R5652:Atp8b1	UTSW	18	64531382	missense	probably benign	0.31
R5653:Atp8b1	UTSW	18	64545197	missense	probably damaging	1.00
R5667:Atp8b1	UTSW	18	64581923	missense	probably damaging	1.00
R5689:Atp8b1	UTSW	18	64564537	missense	probably damaging	1.00
R6008:Atp8b1	UTSW	18	64577616	missense	probably damaging	1.00
R6315:Atp8b1	UTSW	18	64531479	missense	probably damaging	0.97
R6759:Atp8b1	UTSW	18	64546090	missense	probably benign	0.00
R6850:Atp8b1	UTSW	18	64556852	missense	possibly damaging	0.94
R7255:Atp8b1	UTSW	18	64556868	missense	probably damaging	1.00
R7606:Atp8b1	UTSW	18	64555115	missense	probably damaging	1.00
R7635:Atp8b1	UTSW	18	64573305	missense	possibly damaging	0.59
R7639:Atp8b1	UTSW	18	64564543	missense	possibly damaging	0.91
R7698:Atp8b1	UTSW	18	64571022	missense	probably benign	0.03
R7727:Atp8b1	UTSW	18	64545275	missense	probably damaging	1.00
R7779:Atp8b1	UTSW	18	64541382	missense	probably damaging	1.00
R7785:Atp8b1	UTSW	18	64556850	missense	probably damaging	1.00
R7874:Atp8b1	UTSW	18	64571024	missense	probably benign	0.30
R7990:Atp8b1	UTSW	18	64538677	missense	possibly damaging	0.91
R8020:Atp8b1	UTSW	18	64546013	missense	probably damaging	1.00
R8161:Atp8b1	UTSW	18	64556987	missense	probably damaging	1.00
R9007:Atp8b1	UTSW	18	64551860	missense	probably benign	0.40
R9064:Atp8b1	UTSW	18	64564420	missense	probably benign	0.12
R9266:Atp8b1	UTSW	18	64571037	missense	probably benign	0.08
R9266:Atp8b1	UTSW	18	64577457	missense	possibly damaging	0.70
R9326:Atp8b1	UTSW	18	64573273	missense	probably damaging	1.00
X0025:Atp8b1	UTSW	18	64571405	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGACAGGCAATTAATATGCAAAGCC -3'
(R):5'- GTGTATAAGATCCAAATGCTAGGAC -3'

Sequencing Primer
(F):5'- GAAGGTCCGGAGTTCAAATCCC -3'
(R):5'- CCTGGCCCTAGTCTTTATA -3'

Posted On

2016-09-06