Incidental Mutation 'R5400:Incenp'
ID429963
Institutional Source Beutler Lab
Gene Symbol Incenp
Ensembl Gene ENSMUSG00000024660
Gene Nameinner centromere protein
Synonyms2700067E22Rik
MMRRC Submission 042971-MU
Accession Numbers

Genbank: NM_016692

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location9872297-9899533 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 9877675 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025562] [ENSMUST00000025562]
Predicted Effect probably null
Transcript: ENSMUST00000025562
SMART Domains Protein: ENSMUSP00000025562
Gene: ENSMUSG00000024660

DomainStartEndE-ValueType
Pfam:INCENP_N 6 41 1.9e-18 PFAM
low complexity region 83 94 N/A INTRINSIC
low complexity region 123 145 N/A INTRINSIC
low complexity region 308 314 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 434 447 N/A INTRINSIC
low complexity region 517 553 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
SCOP:d1f5na1 631 739 7e-3 SMART
Pfam:INCENP_ARK-bind 789 846 1.5e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000025562
SMART Domains Protein: ENSMUSP00000025562
Gene: ENSMUSG00000024660

DomainStartEndE-ValueType
Pfam:INCENP_N 6 41 1.9e-18 PFAM
low complexity region 83 94 N/A INTRINSIC
low complexity region 123 145 N/A INTRINSIC
low complexity region 308 314 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 434 447 N/A INTRINSIC
low complexity region 517 553 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
SCOP:d1f5na1 631 739 7e-3 SMART
Pfam:INCENP_ARK-bind 789 846 1.5e-22 PFAM
Meta Mutation Damage Score 0.9601 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mammalian cells, 2 broad groups of centromere-interacting proteins have been described: constitutively binding centromere proteins and 'passenger,' or transiently interacting, proteins (reviewed by Choo, 1997). The constitutive proteins include CENPA (centromere protein A; MIM 117139), CENPB (MIM 117140), CENPC1 (MIM 117141), and CENPD (MIM 117142). The term 'passenger proteins' encompasses a broad collection of proteins that localize to the centromere during specific stages of the cell cycle (Earnshaw and Mackay, 1994 [PubMed 8088460]). These include CENPE (MIM 117143); MCAK (MIM 604538); KID (MIM 603213); cytoplasmic dynein (e.g., MIM 600112); CliPs (e.g., MIM 179838); and CENPF/mitosin (MIM 600236). The inner centromere proteins (INCENPs) (Earnshaw and Cooke, 1991 [PubMed 1860899]), the initial members of the passenger protein group, display a broad localization along chromosomes in the early stages of mitosis but gradually become concentrated at centromeres as the cell cycle progresses into mid-metaphase. During telophase, the proteins are located within the midbody in the intercellular bridge, where they are discarded after cytokinesis (Cutts et al., 1999 [PubMed 10369859]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant embryos die before E8.5. Embryonic cells exhibit abnormal nuclei and abberent mitosis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Incenp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Incenp APN 19 9883728 missense unknown
IGL01717:Incenp APN 19 9893265 splice site probably benign
IGL02485:Incenp APN 19 9893368 missense unknown
IGL02488:Incenp APN 19 9893407 missense unknown
B5639:Incenp UTSW 19 9893818 missense unknown
R0060:Incenp UTSW 19 9885459 splice site probably benign
R0164:Incenp UTSW 19 9894879 missense probably benign 0.23
R0164:Incenp UTSW 19 9894879 missense probably benign 0.23
R0242:Incenp UTSW 19 9893750 missense unknown
R0242:Incenp UTSW 19 9893750 missense unknown
R0284:Incenp UTSW 19 9893993 missense unknown
R1264:Incenp UTSW 19 9884015 missense unknown
R1432:Incenp UTSW 19 9885526 missense unknown
R1679:Incenp UTSW 19 9895414 missense unknown
R1827:Incenp UTSW 19 9872729 missense possibly damaging 0.94
R1970:Incenp UTSW 19 9885487 missense unknown
R3082:Incenp UTSW 19 9883779 missense unknown
R3083:Incenp UTSW 19 9883779 missense unknown
R4062:Incenp UTSW 19 9883778 missense unknown
R4063:Incenp UTSW 19 9883778 missense unknown
R4534:Incenp UTSW 19 9883939 missense unknown
R4535:Incenp UTSW 19 9883939 missense unknown
R4536:Incenp UTSW 19 9883939 missense unknown
R4709:Incenp UTSW 19 9876600 missense unknown
R4785:Incenp UTSW 19 9877690 missense unknown
R4785:Incenp UTSW 19 9877691 missense unknown
R5179:Incenp UTSW 19 9894909 missense unknown
R5282:Incenp UTSW 19 9878406 missense unknown
R5502:Incenp UTSW 19 9893364 missense unknown
R5608:Incenp UTSW 19 9893868 small insertion probably benign
R6033:Incenp UTSW 19 9872697 missense probably damaging 0.99
R6033:Incenp UTSW 19 9872697 missense probably damaging 0.99
R6807:Incenp UTSW 19 9877756 missense unknown
R6885:Incenp UTSW 19 9875132 missense unknown
R6959:Incenp UTSW 19 9876770 missense unknown
R7033:Incenp UTSW 19 9893372 missense unknown
R8258:Incenp UTSW 19 9893629 missense unknown
R8258:Incenp UTSW 19 9893641 missense unknown
R8259:Incenp UTSW 19 9893629 missense unknown
R8259:Incenp UTSW 19 9893641 missense unknown
R8293:Incenp UTSW 19 9875133 nonsense probably null
Z1176:Incenp UTSW 19 9877687 missense unknown
Z1177:Incenp UTSW 19 9899364 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCGCTAAGAAACAGCAGATGTG -3'
(R):5'- TCTAGGCTCCATGCTGCATG -3'

Sequencing Primer
(F):5'- TGAAGCCGGGCTCCAAAAG -3'
(R):5'- CTCCATGCTGCATGCTAAGGTAG -3'
Posted On2016-09-06