Mutagenetix > Incidental Mutation

Incidental Mutation 'R5400:Tmc1'

429964

Institutional Source

Beutler Lab

Gene Symbol

Tmc1

Ensembl Gene

ENSMUSG00000024749

Gene Name

transmembrane channel-like gene family 1

Synonyms

4933416G09Rik, Beethoven, Bth

MMRRC Submission

042971-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R5400 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20783458-20954202 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20804602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 584 (I584T)

Ref Sequence

ENSEMBL: ENSMUSP00000040859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039500]

AlphaFold

Q8R4P5

Predicted Effect

probably damaging
Transcript: ENSMUST00000039500
AA Change: I584T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: I584T

Domain	Start	End	E-Value	Type
SCOP:d1eq1a_	2	95	3e-3	SMART
low complexity region	129	150	N/A	INTRINSIC
transmembrane domain	184	206	N/A	INTRINSIC
transmembrane domain	265	287	N/A	INTRINSIC
low complexity region	295	302	N/A	INTRINSIC
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
Pfam:TMC	512	627	2.6e-36	PFAM
transmembrane domain	632	654	N/A	INTRINSIC
transmembrane domain	693	715	N/A	INTRINSIC
low complexity region	738	754	N/A	INTRINSIC

Meta Mutation Damage Score

0.7064

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	T	5: 9,479,247	N1027Y	probably damaging	Het
Accsl	T	C	2: 93,859,422	D380G	probably damaging	Het
Afm	T	C	5: 90,551,398	L567P	possibly damaging	Het
AI481877	A	G	4: 59,082,432	S399P	possibly damaging	Het
Anks1b	A	T	10: 90,512,824	I785L	probably damaging	Het
Arpc5l	G	A	2: 39,013,735	G79S	probably benign	Het
Arvcf	G	T	16: 18,399,070	R440L	probably benign	Het
Atm	T	C	9: 53,503,018	D924G	probably damaging	Het
Atp8b1	A	T	18: 64,545,989		probably null	Het
Cd19	C	T	7: 126,414,452	G55D	probably benign	Het
Cd34	A	G	1: 194,938,958		probably benign	Het
Cd69	T	A	6: 129,269,991	M88L	probably benign	Het
Ces2h	A	G	8: 105,018,425	E397G	probably benign	Het
Ddx60	T	C	8: 62,010,002	F1306L	possibly damaging	Het
Dennd5b	T	C	6: 149,000,016	E1124G	probably damaging	Het
Dio1	A	T	4: 107,306,988	M44K	probably damaging	Het
En1	A	G	1: 120,603,595	D188G	probably damaging	Het
Epha10	C	T	4: 124,914,121		probably benign	Het
Fam120b	A	T	17: 15,403,126	L455F	possibly damaging	Het
Flt4	AC	ACC	11: 49,651,034		probably null	Het
Gm38394	G	A	1: 133,658,141	T486I	probably damaging	Het
Incenp	A	G	19: 9,877,675		probably null	Het
Kansl3	A	G	1: 36,358,149	V86A	possibly damaging	Het
Klhl7	C	G	5: 24,126,920	F73L	probably damaging	Het
Med28	T	A	5: 45,525,199	V69D	probably damaging	Het
Mknk1	T	A	4: 115,864,553	L98Q	probably damaging	Het
Mknk1	C	A	4: 115,864,552	L98M	probably damaging	Het
Myo3b	T	A	2: 70,105,380	C97S	probably damaging	Het
Neto1	A	G	18: 86,395,908	H9R	possibly damaging	Het
Olfr1230	T	C	2: 89,296,913	D119G	probably damaging	Het
Olfr317	T	C	11: 58,732,320	T282A	possibly damaging	Het
Olfr354	A	T	2: 36,907,821	I292F	probably damaging	Het
Olfr78	G	A	7: 102,742,430	T191I	probably benign	Het
Omd	A	T	13: 49,592,227	E371V	probably benign	Het
Osbpl9	G	T	4: 109,062,300	Y733*	probably null	Het
Pcdh12	A	T	18: 38,268,898	S91R	probably damaging	Het
Pxk	C	A	14: 8,136,911	P144Q	probably benign	Het
Qser1	A	G	2: 104,789,874	S198P	probably damaging	Het
Recql	T	G	6: 142,362,347		probably benign	Het
Reln	T	C	5: 21,979,714	D1601G	probably damaging	Het
Scn10a	T	C	9: 119,609,034	D1922G	probably damaging	Het
Scn11a	T	A	9: 119,769,908	R1185S	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc13a4	A	T	6: 35,301,842	C37*	probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc9a9	T	A	9: 94,712,901	F155I	probably damaging	Het
Spef2	T	A	15: 9,614,281	K1193M	probably damaging	Het
Swt1	T	C	1: 151,412,834	T80A	probably benign	Het
Tsc22d1	C	A	14: 76,417,054	F324L	probably benign	Het
Usp19	T	C	9: 108,500,193	V1236A	probably damaging	Het
Vmn2r63	T	C	7: 42,928,211	N301S	probably benign	Het
Wrn	C	T	8: 33,294,917	V476I	probably benign	Het
Zbtb25	C	A	12: 76,349,702	E249*	probably null	Het
Zfp54	C	A	17: 21,433,700	T152K	probably benign	Het

Other mutations in Tmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Tmc1	APN	19	20816192	missense	probably damaging	1.00
IGL02104:Tmc1	APN	19	20832454	missense	probably benign	0.00
IGL02245:Tmc1	APN	19	20799192	missense	probably damaging	1.00
IGL02544:Tmc1	APN	19	20906963	missense	probably benign	0.04
IGL02699:Tmc1	APN	19	20832350	critical splice donor site	probably null
IGL02974:Tmc1	APN	19	20900844	missense	probably benign
IGL03194:Tmc1	APN	19	20804653	missense	probably damaging	1.00
dinner_bell	UTSW	19	20795516	missense	probably damaging	0.99
R0255:Tmc1	UTSW	19	20789587	missense	possibly damaging	0.93
R0381:Tmc1	UTSW	19	20799045	missense	probably damaging	1.00
R0655:Tmc1	UTSW	19	20799176	missense	probably damaging	1.00
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1496:Tmc1	UTSW	19	20868355	missense	probably damaging	1.00
R1542:Tmc1	UTSW	19	20816122	missense	probably damaging	1.00
R1773:Tmc1	UTSW	19	20826501	splice site	probably null
R1777:Tmc1	UTSW	19	20816109	critical splice donor site	probably null
R2067:Tmc1	UTSW	19	20824309	missense	possibly damaging	0.90
R2152:Tmc1	UTSW	19	20856675	missense	probably benign	0.01
R2180:Tmc1	UTSW	19	20824084	missense	probably damaging	0.96
R2204:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2205:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2285:Tmc1	UTSW	19	20789799	missense	probably damaging	0.96
R4505:Tmc1	UTSW	19	20868374	missense	probably benign	0.00
R4752:Tmc1	UTSW	19	20826649	missense	probably benign	0.35
R4975:Tmc1	UTSW	19	20906955	missense	probably damaging	0.96
R5040:Tmc1	UTSW	19	20824030	missense	possibly damaging	0.68
R5206:Tmc1	UTSW	19	20826660	missense	probably damaging	1.00
R5429:Tmc1	UTSW	19	20789622	missense	possibly damaging	0.72
R6200:Tmc1	UTSW	19	20789590	missense	possibly damaging	0.53
R6784:Tmc1	UTSW	19	20827651	critical splice donor site	probably null
R6796:Tmc1	UTSW	19	20799036	missense	probably damaging	1.00
R6808:Tmc1	UTSW	19	20795516	missense	probably damaging	0.99
R6812:Tmc1	UTSW	19	20900861	missense	probably damaging	1.00
R6834:Tmc1	UTSW	19	20795610	nonsense	probably null
R6978:Tmc1	UTSW	19	20804635	missense	probably damaging	1.00
R6986:Tmc1	UTSW	19	20824283	missense	probably benign	0.02
R7027:Tmc1	UTSW	19	20940903	critical splice donor site	probably null
R7378:Tmc1	UTSW	19	20868389	missense	probably damaging	0.98
R7520:Tmc1	UTSW	19	20799178	missense	probably damaging	0.99
R7573:Tmc1	UTSW	19	20907008	missense	probably damaging	0.98
R7825:Tmc1	UTSW	19	20804645	missense	possibly damaging	0.55
R8024:Tmc1	UTSW	19	20900817	missense	probably damaging	1.00
R8073:Tmc1	UTSW	19	20868361	missense	probably benign	0.08
R8786:Tmc1	UTSW	19	20826589	missense	probably damaging	1.00
R8791:Tmc1	UTSW	19	20789845	missense	probably benign	0.00
R8969:Tmc1	UTSW	19	20816229	missense	probably damaging	1.00
R8973:Tmc1	UTSW	19	20900851	missense	probably benign
R9429:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R9493:Tmc1	UTSW	19	20824280	missense	probably benign	0.00
Z1176:Tmc1	UTSW	19	20826506	missense	probably null	1.00
Z1177:Tmc1	UTSW	19	20823982	missense	probably damaging	1.00
Z1177:Tmc1	UTSW	19	20795608	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- TTATTGGAGGGGAACTCTGCC -3'
(R):5'- ATGTTGTAAGGTTTCCATGCTTCTC -3'

Sequencing Primer
(F):5'- AGGGGAACTCTGCCAGTTG -3'
(R):5'- AAGGTTTCCATGCTTCTCATTTTATG -3'

Posted On

2016-09-06