Incidental Mutation 'R5401:Tsc1'
ID429966
Institutional Source Beutler Lab
Gene Symbol Tsc1
Ensembl Gene ENSMUSG00000026812
Gene Nametuberous sclerosis 1
Synonymshamartin
MMRRC Submission 042972-MU
Accession Numbers

Ncbi RefSeq: NM_022887.3; MGI: 1929183

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28641228-28691167 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 28686908 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 1073 (S1073*)
Ref Sequence ENSEMBL: ENSMUSP00000109501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028155] [ENSMUST00000113867] [ENSMUST00000113869] [ENSMUST00000113870] [ENSMUST00000133565]
Predicted Effect probably null
Transcript: ENSMUST00000028155
AA Change: S1073*
SMART Domains Protein: ENSMUSP00000028155
Gene: ENSMUSG00000026812
AA Change: S1073*

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113867
AA Change: S1068*
SMART Domains Protein: ENSMUSP00000109498
Gene: ENSMUSG00000026812
AA Change: S1068*

DomainStartEndE-ValueType
Pfam:Hamartin 2 710 7.3e-279 PFAM
SCOP:d1eq1a_ 718 881 6e-11 SMART
low complexity region 969 985 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1094 1112 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113869
AA Change: S1074*
SMART Domains Protein: ENSMUSP00000109500
Gene: ENSMUSG00000026812
AA Change: S1074*

DomainStartEndE-ValueType
Pfam:Hamartin 7 716 6e-279 PFAM
SCOP:d1eq1a_ 724 887 4e-11 SMART
low complexity region 975 991 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113870
AA Change: S1073*
SMART Domains Protein: ENSMUSP00000109501
Gene: ENSMUSG00000026812
AA Change: S1073*

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133565
SMART Domains Protein: ENSMUSP00000120888
Gene: ENSMUSG00000026812

DomainStartEndE-ValueType
Pfam:Hamartin 2 455 1.3e-198 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
MGI Phenotype Strain: 2183900
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a growth inhibitory protein thought to play a role in the stabilization of tuberin. Mutations in this gene have been associated with tuberous sclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mutants show liver hypoplasia, open neural tube and die by embryonic day 10.5-11.5. Heterozygotes develop kidney cystadenomas and liver hemangiomas. Conditional astrocyte-specific nulls show increased astrocyte numbers and seizures. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(7) Gene trapped(31)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Asna1 A T 8: 85,018,544 I298N possibly damaging Het
Camkk2 T A 5: 122,746,335 D341V probably damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Cracr2b A G 7: 141,466,223 *395W probably null Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fndc8 T G 11: 82,897,850 S169A possibly damaging Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Kctd19 C T 8: 105,382,985 V942I probably benign Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Phf21a C A 2: 92,351,752 T342K possibly damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Plcz1 G T 6: 139,993,052 probably null Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srrm1 A G 4: 135,324,069 probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Vmn2r67 A T 7: 85,136,557 Y747N probably damaging Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zswim2 C T 2: 83,925,245 G104E possibly damaging Het
Other mutations in Tsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tsc1 APN 2 28661611 missense probably damaging 0.98
IGL00770:Tsc1 APN 2 28665011 missense probably damaging 1.00
IGL00774:Tsc1 APN 2 28665011 missense probably damaging 1.00
IGL00835:Tsc1 APN 2 28672466 missense possibly damaging 0.93
IGL00971:Tsc1 APN 2 28670940 nonsense probably null
IGL01808:Tsc1 APN 2 28662507 missense probably damaging 1.00
IGL02281:Tsc1 APN 2 28663595 missense probably damaging 1.00
IGL03068:Tsc1 APN 2 28681258 missense probably damaging 1.00
Cassava UTSW 2 28671886 splice site probably null
R0077:Tsc1 UTSW 2 28678943 splice site probably benign
R0149:Tsc1 UTSW 2 28670901 missense probably damaging 0.99
R0605:Tsc1 UTSW 2 28671778 missense probably damaging 1.00
R0737:Tsc1 UTSW 2 28670930 missense possibly damaging 0.94
R1199:Tsc1 UTSW 2 28665626 missense probably damaging 1.00
R1751:Tsc1 UTSW 2 28676026 missense probably damaging 0.97
R1757:Tsc1 UTSW 2 28686113 missense probably benign 0.05
R1807:Tsc1 UTSW 2 28686113 missense probably benign 0.05
R2014:Tsc1 UTSW 2 28665637 splice site probably benign
R2284:Tsc1 UTSW 2 28665097 missense possibly damaging 0.85
R3786:Tsc1 UTSW 2 28687142 missense probably damaging 1.00
R4490:Tsc1 UTSW 2 28670925 missense probably damaging 0.97
R4707:Tsc1 UTSW 2 28672407 missense probably damaging 1.00
R4751:Tsc1 UTSW 2 28679081 missense probably damaging 0.96
R4794:Tsc1 UTSW 2 28661690 splice site probably null
R4906:Tsc1 UTSW 2 28675189 missense possibly damaging 0.81
R5020:Tsc1 UTSW 2 28676519 missense probably damaging 1.00
R5708:Tsc1 UTSW 2 28665185 intron probably benign
R6435:Tsc1 UTSW 2 28676452 missense probably benign 0.08
R6469:Tsc1 UTSW 2 28671886 splice site probably null
R6502:Tsc1 UTSW 2 28665601 missense probably damaging 1.00
R6617:Tsc1 UTSW 2 28686989 missense possibly damaging 0.82
R7098:Tsc1 UTSW 2 28675732 missense probably benign 0.00
R7503:Tsc1 UTSW 2 28687076 missense possibly damaging 0.50
R7608:Tsc1 UTSW 2 28658736 missense probably benign 0.01
R7677:Tsc1 UTSW 2 28672817 missense probably benign 0.11
R7791:Tsc1 UTSW 2 28681948 missense probably damaging 1.00
R8021:Tsc1 UTSW 2 28686889 missense possibly damaging 0.67
R8228:Tsc1 UTSW 2 28676129 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGGATGCACAGATTCCTTGGTAG -3'
(R):5'- GGCATCTAGACTCAGGGAAGTC -3'

Sequencing Primer
(F):5'- CATAATGAAGAGGCTTCTGGTCAC -3'
(R):5'- CTAGACTCAGGGAAGTCTTGTTTTC -3'
Posted On2016-09-06