Incidental Mutation 'R5401:Zswim2'
ID429967
Institutional Source Beutler Lab
Gene Symbol Zswim2
Ensembl Gene ENSMUSG00000034552
Gene Namezinc finger SWIM-type containing 2
Synonyms4933437F18Rik, MEX, 1700025P14Rik
MMRRC Submission 042972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location83915079-83941228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83925245 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 104 (G104E)
Ref Sequence ENSEMBL: ENSMUSP00000044913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038223] [ENSMUST00000152829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038223
AA Change: G104E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044913
Gene: ENSMUSG00000034552
AA Change: G104E

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.4e-7 PFAM
RING 147 198 8.3e-5 SMART
ZnF_ZZ 229 273 1.8e-5 SMART
RING 344 385 1.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152829
AA Change: G104E

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119439
Gene: ENSMUSG00000034552
AA Change: G104E

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.6e-10 PFAM
RING 147 198 1.69e-2 SMART
ZnF_ZZ 229 273 3.65e-3 SMART
Blast:RING 344 365 3e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155127
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Asna1 A T 8: 85,018,544 I298N possibly damaging Het
Camkk2 T A 5: 122,746,335 D341V probably damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Cracr2b A G 7: 141,466,223 *395W probably null Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fndc8 T G 11: 82,897,850 S169A possibly damaging Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Kctd19 C T 8: 105,382,985 V942I probably benign Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Phf21a C A 2: 92,351,752 T342K possibly damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Plcz1 G T 6: 139,993,052 probably null Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srrm1 A G 4: 135,324,069 probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tsc1 C A 2: 28,686,908 S1073* probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Vmn2r67 A T 7: 85,136,557 Y747N probably damaging Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Other mutations in Zswim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Zswim2 APN 2 83923771 missense probably benign 0.00
IGL01140:Zswim2 APN 2 83915328 missense probably benign 0.06
IGL01362:Zswim2 APN 2 83915346 missense probably benign 0.09
IGL01768:Zswim2 APN 2 83917957 missense probably benign 0.00
IGL02166:Zswim2 APN 2 83915406 nonsense probably null
IGL02187:Zswim2 APN 2 83923638 missense probably damaging 0.98
IGL02239:Zswim2 APN 2 83938763 nonsense probably null
IGL02629:Zswim2 APN 2 83925209 missense possibly damaging 0.94
R0609:Zswim2 UTSW 2 83923659 missense probably benign 0.02
R0943:Zswim2 UTSW 2 83917998 missense possibly damaging 0.88
R0946:Zswim2 UTSW 2 83923759 missense probably benign 0.10
R1006:Zswim2 UTSW 2 83915393 missense probably damaging 0.97
R1191:Zswim2 UTSW 2 83923695 missense possibly damaging 0.60
R1309:Zswim2 UTSW 2 83938756 missense probably damaging 1.00
R1549:Zswim2 UTSW 2 83923748 missense probably benign 0.24
R1563:Zswim2 UTSW 2 83915282 missense possibly damaging 0.71
R1739:Zswim2 UTSW 2 83915340 nonsense probably null
R1994:Zswim2 UTSW 2 83915663 missense possibly damaging 0.95
R4039:Zswim2 UTSW 2 83915994 missense probably damaging 1.00
R4645:Zswim2 UTSW 2 83915547 missense probably benign 0.00
R4738:Zswim2 UTSW 2 83915395 missense probably benign 0.16
R4855:Zswim2 UTSW 2 83916843 critical splice donor site probably null
R4933:Zswim2 UTSW 2 83925227 missense probably damaging 1.00
R4963:Zswim2 UTSW 2 83925110 missense probably damaging 1.00
R5153:Zswim2 UTSW 2 83939666 missense possibly damaging 0.75
R5698:Zswim2 UTSW 2 83925183 missense possibly damaging 0.92
R6002:Zswim2 UTSW 2 83915688 missense probably damaging 0.98
R6396:Zswim2 UTSW 2 83923718 missense probably damaging 1.00
R6447:Zswim2 UTSW 2 83915113 unclassified probably null
R6646:Zswim2 UTSW 2 83915784 nonsense probably null
R6717:Zswim2 UTSW 2 83915409 missense probably benign 0.02
R6735:Zswim2 UTSW 2 83923761 missense probably benign 0.04
R6830:Zswim2 UTSW 2 83939684 missense probably damaging 1.00
R7056:Zswim2 UTSW 2 83920748 critical splice acceptor site probably null
R7088:Zswim2 UTSW 2 83915727 nonsense probably null
R7383:Zswim2 UTSW 2 83915328 missense possibly damaging 0.95
R7440:Zswim2 UTSW 2 83920719 missense probably damaging 1.00
R7747:Zswim2 UTSW 2 83915607 missense probably damaging 0.97
X0018:Zswim2 UTSW 2 83941094 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTTAGAGTACAAAAGCATCACCTG -3'
(R):5'- CGTGATGCAGGCTGTACTAG -3'

Sequencing Primer
(F):5'- CCTGCAGAAGGTGACAGG -3'
(R):5'- TGTACTAGCTTCAGTAACAAGATGGG -3'
Posted On2016-09-06