Incidental Mutation 'R5401:Phf21a'
ID429968
Institutional Source Beutler Lab
Gene Symbol Phf21a
Ensembl Gene ENSMUSG00000058318
Gene NamePHD finger protein 21A
SynonymsPFTF1, Bhc80, Braf35/HDAC complex (Bhc), 80kDa, D030065N23Rik
MMRRC Submission 042972-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location92093117-92364666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92351752 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 342 (T342K)
Ref Sequence ENSEMBL: ENSMUSP00000123955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044036] [ENSMUST00000068702] [ENSMUST00000090586] [ENSMUST00000111290] [ENSMUST00000111291] [ENSMUST00000111292] [ENSMUST00000111293] [ENSMUST00000111294] [ENSMUST00000111297] [ENSMUST00000159961]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044036
AA Change: T371K

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038497
Gene: ENSMUSG00000058318
AA Change: T371K

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068702
SMART Domains Protein: ENSMUSP00000070649
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090586
AA Change: T455K

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000088074
Gene: ENSMUSG00000058318
AA Change: T455K

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111290
AA Change: T426K

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106921
Gene: ENSMUSG00000058318
AA Change: T426K

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 405 417 4.28e-1 SMART
low complexity region 424 436 N/A INTRINSIC
PHD 470 513 3.12e-15 SMART
RING 471 512 1.85e-1 SMART
coiled coil region 537 582 N/A INTRINSIC
low complexity region 630 650 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111291
AA Change: T371K

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106922
Gene: ENSMUSG00000058318
AA Change: T371K

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111292
SMART Domains Protein: ENSMUSP00000106923
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111293
AA Change: T455K

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106924
Gene: ENSMUSG00000058318
AA Change: T455K

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111294
SMART Domains Protein: ENSMUSP00000106925
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
PHD 452 495 3.12e-15 SMART
RING 453 494 1.85e-1 SMART
coiled coil region 519 564 N/A INTRINSIC
low complexity region 612 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111297
SMART Domains Protein: ENSMUSP00000106928
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
PHD 422 465 3.12e-15 SMART
RING 423 464 1.85e-1 SMART
coiled coil region 489 534 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159961
AA Change: T342K

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123955
Gene: ENSMUSG00000058318
AA Change: T342K

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 57 100 N/A INTRINSIC
low complexity region 136 157 N/A INTRINSIC
AT_hook 321 333 4.28e-1 SMART
low complexity region 340 352 N/A INTRINSIC
PHD 386 429 3.12e-15 SMART
RING 387 428 1.85e-1 SMART
coiled coil region 453 498 N/A INTRINSIC
low complexity region 546 566 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161044
Predicted Effect probably benign
Transcript: ENSMUST00000161067
SMART Domains Protein: ENSMUSP00000124255
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
PHD 140 183 3.12e-15 SMART
RING 141 182 1.85e-1 SMART
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The PHF21A gene encodes BHC80, a component of a BRAF35 (MIM 605535)/histone deacetylase (HDAC; see MIM 601241) complex (BHC) that mediates repression of neuron-specific genes through the cis-regulatory element known as repressor element-1 (RE1) or neural restrictive silencer (NRS) (Hakimi et al., 2002 [PubMed 12032298]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and insufficient milk-sucking behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Asna1 A T 8: 85,018,544 I298N possibly damaging Het
Camkk2 T A 5: 122,746,335 D341V probably damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Cracr2b A G 7: 141,466,223 *395W probably null Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fndc8 T G 11: 82,897,850 S169A possibly damaging Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Kctd19 C T 8: 105,382,985 V942I probably benign Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Plcz1 G T 6: 139,993,052 probably null Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srrm1 A G 4: 135,324,069 probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tsc1 C A 2: 28,686,908 S1073* probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Vmn2r67 A T 7: 85,136,557 Y747N probably damaging Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zswim2 C T 2: 83,925,245 G104E possibly damaging Het
Other mutations in Phf21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Phf21a APN 2 92348029 missense probably damaging 1.00
IGL00826:Phf21a APN 2 92344536 splice site probably benign
IGL01859:Phf21a APN 2 92328356 missense probably damaging 1.00
IGL02124:Phf21a APN 2 92349422 missense probably damaging 1.00
IGL02724:Phf21a APN 2 92360247 missense probably damaging 1.00
IGL03155:Phf21a APN 2 92320266 missense probably damaging 0.99
R0308:Phf21a UTSW 2 92330777 missense possibly damaging 0.86
R1251:Phf21a UTSW 2 92359199 missense probably benign 0.00
R1739:Phf21a UTSW 2 92360299 missense possibly damaging 0.95
R1775:Phf21a UTSW 2 92330515 missense probably damaging 1.00
R2013:Phf21a UTSW 2 92228483 critical splice donor site probably null
R2064:Phf21a UTSW 2 92327077 missense possibly damaging 0.47
R2073:Phf21a UTSW 2 92348036 missense probably damaging 1.00
R4698:Phf21a UTSW 2 92356952 missense probably damaging 1.00
R4901:Phf21a UTSW 2 92357001 nonsense probably null
R5055:Phf21a UTSW 2 92351856 missense probably damaging 1.00
R5249:Phf21a UTSW 2 92228477 missense probably damaging 1.00
R5770:Phf21a UTSW 2 92351854 missense possibly damaging 0.52
R5969:Phf21a UTSW 2 92221611 missense probably damaging 0.98
R6008:Phf21a UTSW 2 92351752 missense possibly damaging 0.71
R6012:Phf21a UTSW 2 92351775 missense probably damaging 1.00
R6128:Phf21a UTSW 2 92351608 critical splice acceptor site probably null
R6354:Phf21a UTSW 2 92348937 missense probably damaging 1.00
R7075:Phf21a UTSW 2 92360379 nonsense probably null
R7117:Phf21a UTSW 2 92359157 missense probably benign 0.25
R7270:Phf21a UTSW 2 92327139 missense probably damaging 0.98
R7603:Phf21a UTSW 2 92357007 missense probably benign 0.08
R7708:Phf21a UTSW 2 92327166 critical splice donor site probably null
Z1177:Phf21a UTSW 2 92230714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTATGCTCCAAGACTCCC -3'
(R):5'- GCACAGGACAATGGCTTTCC -3'

Sequencing Primer
(F):5'- GGATTCATGTAGTCGTTTCTAATGAC -3'
(R):5'- TCCCATGTGAGCTCTCAGAG -3'
Posted On2016-09-06