Incidental Mutation 'R5401:Srrm1'
ID429975
Institutional Source Beutler Lab
Gene Symbol Srrm1
Ensembl Gene ENSMUSG00000028809
Gene Nameserine/arginine repetitive matrix 1
SynonymsSRm160
MMRRC Submission 042972-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location135320484-135353321 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 135324069 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030613] [ENSMUST00000084846] [ENSMUST00000105861] [ENSMUST00000136342]
Predicted Effect unknown
Transcript: ENSMUST00000030613
AA Change: S767P
SMART Domains Protein: ENSMUSP00000030613
Gene: ENSMUSG00000028809
AA Change: S767P

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 4.31e-5 PROSPERO
internal_repeat_1 427 456 3.46e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 555 661 N/A INTRINSIC
internal_repeat_1 666 700 3.46e-6 PROSPERO
internal_repeat_3 670 693 4.31e-5 PROSPERO
internal_repeat_4 684 698 4.31e-5 PROSPERO
internal_repeat_2 689 734 4.31e-5 PROSPERO
internal_repeat_3 719 740 4.31e-5 PROSPERO
internal_repeat_5 730 740 8.09e-5 PROSPERO
low complexity region 746 795 N/A INTRINSIC
internal_repeat_4 799 813 4.31e-5 PROSPERO
internal_repeat_5 808 818 8.09e-5 PROSPERO
low complexity region 827 851 N/A INTRINSIC
low complexity region 854 886 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000084846
AA Change: S762P
SMART Domains Protein: ENSMUSP00000081906
Gene: ENSMUSG00000028809
AA Change: S762P

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 402 N/A INTRINSIC
internal_repeat_2 404 450 3.57e-5 PROSPERO
internal_repeat_1 422 451 2.79e-6 PROSPERO
low complexity region 471 495 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 550 656 N/A INTRINSIC
internal_repeat_1 661 695 2.79e-6 PROSPERO
internal_repeat_3 665 688 3.57e-5 PROSPERO
internal_repeat_4 679 693 3.57e-5 PROSPERO
internal_repeat_2 684 729 3.57e-5 PROSPERO
internal_repeat_3 714 735 3.57e-5 PROSPERO
internal_repeat_5 725 735 6.75e-5 PROSPERO
low complexity region 741 790 N/A INTRINSIC
internal_repeat_4 794 808 3.57e-5 PROSPERO
internal_repeat_5 803 813 6.75e-5 PROSPERO
low complexity region 822 846 N/A INTRINSIC
low complexity region 849 886 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105861
AA Change: S753P
SMART Domains Protein: ENSMUSP00000101487
Gene: ENSMUSG00000028809
AA Change: S753P

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 1.99e-5 PROSPERO
internal_repeat_1 427 456 1.45e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 539 647 N/A INTRINSIC
internal_repeat_1 652 686 1.45e-6 PROSPERO
internal_repeat_3 656 679 1.99e-5 PROSPERO
internal_repeat_4 670 684 1.99e-5 PROSPERO
internal_repeat_2 675 720 1.99e-5 PROSPERO
internal_repeat_3 705 726 1.99e-5 PROSPERO
internal_repeat_5 716 726 3.82e-5 PROSPERO
low complexity region 732 781 N/A INTRINSIC
internal_repeat_4 785 799 1.99e-5 PROSPERO
internal_repeat_5 794 804 3.82e-5 PROSPERO
low complexity region 813 837 N/A INTRINSIC
low complexity region 840 877 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136342
AA Change: S767P
SMART Domains Protein: ENSMUSP00000125003
Gene: ENSMUSG00000028809
AA Change: S767P

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 3.36e-5 PROSPERO
internal_repeat_1 427 456 2.61e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 555 661 N/A INTRINSIC
internal_repeat_1 666 700 2.61e-6 PROSPERO
internal_repeat_3 670 693 3.36e-5 PROSPERO
internal_repeat_4 684 698 3.36e-5 PROSPERO
internal_repeat_2 689 734 3.36e-5 PROSPERO
internal_repeat_3 719 740 3.36e-5 PROSPERO
internal_repeat_5 730 740 6.37e-5 PROSPERO
low complexity region 746 795 N/A INTRINSIC
internal_repeat_4 799 813 3.36e-5 PROSPERO
internal_repeat_5 808 818 6.37e-5 PROSPERO
low complexity region 827 851 N/A INTRINSIC
low complexity region 854 891 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136570
Predicted Effect probably benign
Transcript: ENSMUST00000140050
SMART Domains Protein: ENSMUSP00000120952
Gene: ENSMUSG00000028809

DomainStartEndE-ValueType
low complexity region 2 107 N/A INTRINSIC
internal_repeat_1 116 145 9.96e-7 PROSPERO
internal_repeat_1 165 196 9.96e-7 PROSPERO
low complexity region 202 225 N/A INTRINSIC
low complexity region 257 281 N/A INTRINSIC
low complexity region 284 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150619
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Asna1 A T 8: 85,018,544 I298N possibly damaging Het
Camkk2 T A 5: 122,746,335 D341V probably damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Cracr2b A G 7: 141,466,223 *395W probably null Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fndc8 T G 11: 82,897,850 S169A possibly damaging Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Kctd19 C T 8: 105,382,985 V942I probably benign Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Phf21a C A 2: 92,351,752 T342K possibly damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Plcz1 G T 6: 139,993,052 probably null Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tsc1 C A 2: 28,686,908 S1073* probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Vmn2r67 A T 7: 85,136,557 Y747N probably damaging Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zswim2 C T 2: 83,925,245 G104E possibly damaging Het
Other mutations in Srrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Srrm1 APN 4 135347207 splice site probably null
IGL02070:Srrm1 APN 4 135325104 missense unknown
IGL02073:Srrm1 APN 4 135325104 missense unknown
IGL02193:Srrm1 APN 4 135325104 missense unknown
IGL02232:Srrm1 APN 4 135353116 start codon destroyed probably null 1.00
IGL02377:Srrm1 APN 4 135325104 missense unknown
IGL02379:Srrm1 APN 4 135325104 missense unknown
IGL02380:Srrm1 APN 4 135325104 missense unknown
IGL02382:Srrm1 APN 4 135325104 missense unknown
IGL02386:Srrm1 APN 4 135325104 missense unknown
IGL02387:Srrm1 APN 4 135325104 missense unknown
IGL02393:Srrm1 APN 4 135321414 unclassified probably benign
IGL02436:Srrm1 APN 4 135325104 missense unknown
IGL02438:Srrm1 APN 4 135325104 missense unknown
IGL02439:Srrm1 APN 4 135325104 missense unknown
IGL02440:Srrm1 APN 4 135325104 missense unknown
IGL02500:Srrm1 APN 4 135325104 missense unknown
IGL02561:Srrm1 APN 4 135325104 missense unknown
IGL02562:Srrm1 APN 4 135325104 missense unknown
IGL02566:Srrm1 APN 4 135325104 missense unknown
IGL02567:Srrm1 APN 4 135325104 missense unknown
IGL02568:Srrm1 APN 4 135325104 missense unknown
IGL02569:Srrm1 APN 4 135325104 missense unknown
IGL02570:Srrm1 APN 4 135325104 missense unknown
IGL02572:Srrm1 APN 4 135325104 missense unknown
IGL02583:Srrm1 APN 4 135325104 missense unknown
IGL02584:Srrm1 APN 4 135325104 missense unknown
IGL02585:Srrm1 APN 4 135325104 missense unknown
IGL02586:Srrm1 APN 4 135325104 missense unknown
IGL02587:Srrm1 APN 4 135325104 missense unknown
IGL02588:Srrm1 APN 4 135325104 missense unknown
IGL02589:Srrm1 APN 4 135325104 missense unknown
IGL02596:Srrm1 APN 4 135325104 missense unknown
IGL02597:Srrm1 APN 4 135325104 missense unknown
IGL02601:Srrm1 APN 4 135325104 missense unknown
IGL02602:Srrm1 APN 4 135325104 missense unknown
IGL02609:Srrm1 APN 4 135325104 missense unknown
IGL02614:Srrm1 APN 4 135325104 missense unknown
IGL02631:Srrm1 APN 4 135325104 missense unknown
IGL02632:Srrm1 APN 4 135325104 missense unknown
IGL02657:Srrm1 APN 4 135325104 missense unknown
IGL02658:Srrm1 APN 4 135325104 missense unknown
IGL02659:Srrm1 APN 4 135325104 missense unknown
IGL02660:Srrm1 APN 4 135325104 missense unknown
IGL02677:Srrm1 APN 4 135325104 missense unknown
IGL02683:Srrm1 APN 4 135325104 missense unknown
IGL02686:Srrm1 APN 4 135325104 missense unknown
IGL02690:Srrm1 APN 4 135325104 missense unknown
IGL02713:Srrm1 APN 4 135325104 missense unknown
IGL02723:Srrm1 APN 4 135325104 missense unknown
IGL02724:Srrm1 APN 4 135325104 missense unknown
IGL02725:Srrm1 APN 4 135325104 missense unknown
IGL02730:Srrm1 APN 4 135325104 missense unknown
IGL02731:Srrm1 APN 4 135325104 missense unknown
IGL02732:Srrm1 APN 4 135325104 missense unknown
IGL02733:Srrm1 APN 4 135325104 missense unknown
IGL02734:Srrm1 APN 4 135325104 missense unknown
IGL02743:Srrm1 APN 4 135325104 missense unknown
IGL02744:Srrm1 APN 4 135325104 missense unknown
IGL02752:Srrm1 APN 4 135325104 missense unknown
Serious UTSW 4 135340926 nonsense probably null
R0131:Srrm1 UTSW 4 135340573 nonsense probably null
R0131:Srrm1 UTSW 4 135340573 nonsense probably null
R0132:Srrm1 UTSW 4 135340573 nonsense probably null
R0510:Srrm1 UTSW 4 135338543 intron probably benign
R0691:Srrm1 UTSW 4 135324991 nonsense probably null
R1337:Srrm1 UTSW 4 135346733 critical splice donor site probably null
R1397:Srrm1 UTSW 4 135321431 unclassified probably benign
R2883:Srrm1 UTSW 4 135321411 unclassified probably benign
R4043:Srrm1 UTSW 4 135340931 unclassified probably benign
R4772:Srrm1 UTSW 4 135342379 unclassified probably benign
R4837:Srrm1 UTSW 4 135345512 intron probably benign
R4975:Srrm1 UTSW 4 135346720 splice site probably benign
R6144:Srrm1 UTSW 4 135337873 unclassified probably benign
R6542:Srrm1 UTSW 4 135340926 nonsense probably null
R7147:Srrm1 UTSW 4 135346826 missense probably damaging 0.98
R8054:Srrm1 UTSW 4 135325015 missense unknown
Z1177:Srrm1 UTSW 4 135323998 missense unknown
Z1177:Srrm1 UTSW 4 135331741 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGAATTGTTAAGTACTGTCCCC -3'
(R):5'- ATGACCCGTCAGGAAAGTGG -3'

Sequencing Primer
(F):5'- ATGTCCAAAACCAGGTAGGC -3'
(R):5'- GCAGAATTGTAGGGAATGTGTGACC -3'
Posted On2016-09-06