Incidental Mutation 'R5401:Plcz1'
ID429987
Institutional Source Beutler Lab
Gene Symbol Plcz1
Ensembl Gene ENSMUSG00000030230
Gene Namephospholipase C, zeta 1
Synonyms1700041H07Rik
MMRRC Submission 042972-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location139989673-140041457 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 139993052 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032356] [ENSMUST00000032356] [ENSMUST00000129986] [ENSMUST00000129986] [ENSMUST00000137148] [ENSMUST00000137148]
Predicted Effect probably null
Transcript: ENSMUST00000032356
SMART Domains Protein: ENSMUSP00000032356
Gene: ENSMUSG00000030230

DomainStartEndE-ValueType
Pfam:EF-hand_like 80 162 9.6e-26 PFAM
PLCXc 163 307 5.17e-72 SMART
low complexity region 374 385 N/A INTRINSIC
PLCYc 386 502 1.52e-51 SMART
C2 521 625 2.06e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000032356
SMART Domains Protein: ENSMUSP00000032356
Gene: ENSMUSG00000030230

DomainStartEndE-ValueType
Pfam:EF-hand_like 80 162 9.6e-26 PFAM
PLCXc 163 307 5.17e-72 SMART
low complexity region 374 385 N/A INTRINSIC
PLCYc 386 502 1.52e-51 SMART
C2 521 625 2.06e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129986
Predicted Effect probably benign
Transcript: ENSMUST00000129986
Predicted Effect probably benign
Transcript: ENSMUST00000137148
Predicted Effect probably benign
Transcript: ENSMUST00000137148
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the phosphoinositide-specific phospholipase C family. Members in this family, classified into six isotypes that are tissue- and organ-specific, hydrolyze phosphatidylinositol 4,5-bisphosphate just before the phosphate group to yield diacylglycerol and inositol 1,4,5-trisphosphate. This protein localizes to the acrosome in spermatozoa and elicits Ca(2+) oscillations and egg activation during fertilization that leads to early embryonic development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous knockout mice display normal spermatogenesis and sperm motility but are sub-fertile because of a failure to induce Ca2+ oscillations in oocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Asna1 A T 8: 85,018,544 I298N possibly damaging Het
Camkk2 T A 5: 122,746,335 D341V probably damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Cracr2b A G 7: 141,466,223 *395W probably null Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fndc8 T G 11: 82,897,850 S169A possibly damaging Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Kctd19 C T 8: 105,382,985 V942I probably benign Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Phf21a C A 2: 92,351,752 T342K possibly damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srrm1 A G 4: 135,324,069 probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tsc1 C A 2: 28,686,908 S1073* probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Vmn2r67 A T 7: 85,136,557 Y747N probably damaging Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zswim2 C T 2: 83,925,245 G104E possibly damaging Het
Other mutations in Plcz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Plcz1 APN 6 140002256 splice site probably benign
IGL01825:Plcz1 APN 6 140003916 missense probably benign 0.03
IGL01885:Plcz1 APN 6 140002111 missense probably benign 0.14
IGL02539:Plcz1 APN 6 139992964 missense probably benign 0.06
IGL02754:Plcz1 APN 6 140010581 missense probably benign 0.00
IGL03379:Plcz1 APN 6 139990764 missense possibly damaging 0.69
IGL03412:Plcz1 APN 6 140016097 missense probably damaging 0.99
R0005:Plcz1 UTSW 6 140040564 splice site probably benign
R0034:Plcz1 UTSW 6 140020448 utr 3 prime probably benign
R0078:Plcz1 UTSW 6 139989784 missense probably damaging 1.00
R0142:Plcz1 UTSW 6 140007697 missense probably damaging 1.00
R0200:Plcz1 UTSW 6 139990733 missense probably damaging 1.00
R0399:Plcz1 UTSW 6 140023230 missense possibly damaging 0.95
R0599:Plcz1 UTSW 6 140028542 missense probably benign
R0608:Plcz1 UTSW 6 139990733 missense probably damaging 1.00
R1854:Plcz1 UTSW 6 139993049 missense probably benign 0.36
R2212:Plcz1 UTSW 6 140002081 missense probably damaging 0.98
R2895:Plcz1 UTSW 6 140023151 missense possibly damaging 0.79
R3413:Plcz1 UTSW 6 140002081 missense probably damaging 0.98
R4239:Plcz1 UTSW 6 140040618 unclassified probably null
R4441:Plcz1 UTSW 6 139990687 missense probably benign 0.00
R4889:Plcz1 UTSW 6 140007748 missense probably benign 0.00
R4953:Plcz1 UTSW 6 140028551 missense possibly damaging 0.89
R5175:Plcz1 UTSW 6 140039663 missense possibly damaging 0.94
R5359:Plcz1 UTSW 6 140028452 missense probably damaging 1.00
R5505:Plcz1 UTSW 6 140016216 missense probably damaging 0.99
R5558:Plcz1 UTSW 6 140039755 missense probably damaging 1.00
R5581:Plcz1 UTSW 6 140023125 missense probably damaging 1.00
R6252:Plcz1 UTSW 6 140007603 critical splice donor site probably null
R6569:Plcz1 UTSW 6 140007707 missense possibly damaging 0.62
R6750:Plcz1 UTSW 6 140028438 missense possibly damaging 0.74
R7073:Plcz1 UTSW 6 140023123 nonsense probably null
R7204:Plcz1 UTSW 6 140010424 missense probably benign 0.05
R7309:Plcz1 UTSW 6 140023156 missense probably damaging 1.00
R7446:Plcz1 UTSW 6 140013586 missense possibly damaging 0.63
R7503:Plcz1 UTSW 6 139990748 missense probably damaging 1.00
R7634:Plcz1 UTSW 6 140016127 missense probably damaging 1.00
Z1176:Plcz1 UTSW 6 140013676 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GAATTTCCTCAGAGACATTCACAC -3'
(R):5'- CAGTGCTTTAGACAGATTCTTGTTC -3'

Sequencing Primer
(F):5'- TTTCCTCAGAGACATTCACACAAAAC -3'
(R):5'- CTGGTTTGCCAGCTTCA -3'
Posted On2016-09-06