Incidental Mutation 'R5401:Vmn2r67'
ID429990
Institutional Source Beutler Lab
Gene Symbol Vmn2r67
Ensembl Gene ENSMUSG00000095664
Gene Namevomeronasal 2, receptor 67
SynonymsEG620672
MMRRC Submission 042972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85136240-85155902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85136557 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 747 (Y747N)
Ref Sequence ENSEMBL: ENSMUSP00000126007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168730]
Predicted Effect probably damaging
Transcript: ENSMUST00000168730
AA Change: Y747N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126007
Gene: ENSMUSG00000095664
AA Change: Y747N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 464 2.1e-31 PFAM
Pfam:NCD3G 507 559 4.8e-19 PFAM
Pfam:7tm_3 590 827 1.4e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Asna1 A T 8: 85,018,544 I298N possibly damaging Het
Camkk2 T A 5: 122,746,335 D341V probably damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Cracr2b A G 7: 141,466,223 *395W probably null Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fndc8 T G 11: 82,897,850 S169A possibly damaging Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Kctd19 C T 8: 105,382,985 V942I probably benign Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Phf21a C A 2: 92,351,752 T342K possibly damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Plcz1 G T 6: 139,993,052 probably null Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srrm1 A G 4: 135,324,069 probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tsc1 C A 2: 28,686,908 S1073* probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zswim2 C T 2: 83,925,245 G104E possibly damaging Het
Other mutations in Vmn2r67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Vmn2r67 APN 7 85151930 missense probably damaging 1.00
IGL01346:Vmn2r67 APN 7 85136919 missense probably damaging 1.00
IGL01373:Vmn2r67 APN 7 85136626 missense probably benign 0.10
IGL01674:Vmn2r67 APN 7 85136443 missense probably damaging 1.00
IGL01978:Vmn2r67 APN 7 85151441 critical splice donor site probably null
IGL02013:Vmn2r67 APN 7 85151655 missense probably benign 0.09
IGL02115:Vmn2r67 APN 7 85151579 missense probably damaging 0.99
IGL02250:Vmn2r67 APN 7 85155800 missense probably benign
IGL02252:Vmn2r67 APN 7 85155800 missense probably benign
IGL02328:Vmn2r67 APN 7 85150690 missense probably benign 0.41
IGL02740:Vmn2r67 APN 7 85136610 missense probably damaging 1.00
IGL02940:Vmn2r67 APN 7 85136743 missense probably benign 0.07
IGL03237:Vmn2r67 APN 7 85149910 missense probably damaging 1.00
R0512:Vmn2r67 UTSW 7 85150692 missense probably damaging 1.00
R1029:Vmn2r67 UTSW 7 85136766 missense probably damaging 1.00
R1193:Vmn2r67 UTSW 7 85151445 missense probably damaging 0.98
R1282:Vmn2r67 UTSW 7 85136724 missense probably benign
R1416:Vmn2r67 UTSW 7 85151616 missense probably benign 0.06
R1429:Vmn2r67 UTSW 7 85152823 missense possibly damaging 0.65
R1462:Vmn2r67 UTSW 7 85155838 missense probably benign 0.00
R1462:Vmn2r67 UTSW 7 85155838 missense probably benign 0.00
R1970:Vmn2r67 UTSW 7 85151805 missense probably benign
R2229:Vmn2r67 UTSW 7 85152042 missense probably benign 0.21
R2246:Vmn2r67 UTSW 7 85136556 missense probably damaging 1.00
R2262:Vmn2r67 UTSW 7 85136974 missense probably damaging 0.96
R2398:Vmn2r67 UTSW 7 85136713 missense probably damaging 1.00
R4249:Vmn2r67 UTSW 7 85150514 splice site probably null
R4666:Vmn2r67 UTSW 7 85150623 missense probably benign
R4669:Vmn2r67 UTSW 7 85150524 missense probably benign 0.11
R4966:Vmn2r67 UTSW 7 85136385 missense probably damaging 1.00
R5264:Vmn2r67 UTSW 7 85152245 missense probably damaging 1.00
R5296:Vmn2r67 UTSW 7 85137022 missense probably damaging 1.00
R5327:Vmn2r67 UTSW 7 85136490 missense probably damaging 1.00
R5510:Vmn2r67 UTSW 7 85151815 missense probably benign 0.39
R5574:Vmn2r67 UTSW 7 85151891 missense probably benign 0.00
R5643:Vmn2r67 UTSW 7 85149943 nonsense probably null
R5914:Vmn2r67 UTSW 7 85151836 missense probably damaging 1.00
R6248:Vmn2r67 UTSW 7 85150560 missense probably damaging 0.99
R6291:Vmn2r67 UTSW 7 85149934 missense possibly damaging 0.88
R6309:Vmn2r67 UTSW 7 85151916 missense probably benign
R6442:Vmn2r67 UTSW 7 85155838 missense possibly damaging 0.82
R6665:Vmn2r67 UTSW 7 85136692 missense probably benign 0.07
R6701:Vmn2r67 UTSW 7 85152815 missense probably damaging 1.00
R6848:Vmn2r67 UTSW 7 85152632 missense probably benign 0.00
R6852:Vmn2r67 UTSW 7 85152153 missense probably damaging 0.99
R6991:Vmn2r67 UTSW 7 85155745 missense possibly damaging 0.55
R7143:Vmn2r67 UTSW 7 85152638 missense probably benign
R7197:Vmn2r67 UTSW 7 85136566 missense possibly damaging 0.77
R7393:Vmn2r67 UTSW 7 85155878 missense probably null 0.87
R7420:Vmn2r67 UTSW 7 85136736 missense possibly damaging 0.52
R7622:Vmn2r67 UTSW 7 85136454 missense probably damaging 1.00
R7664:Vmn2r67 UTSW 7 85155811 missense probably benign 0.21
R7665:Vmn2r67 UTSW 7 85151988 nonsense probably null
R7896:Vmn2r67 UTSW 7 85136712 missense probably damaging 1.00
R7913:Vmn2r67 UTSW 7 85151828 missense possibly damaging 0.87
R7979:Vmn2r67 UTSW 7 85136712 missense probably damaging 1.00
R7994:Vmn2r67 UTSW 7 85151828 missense possibly damaging 0.87
R8026:Vmn2r67 UTSW 7 85136716 missense probably damaging 1.00
R8114:Vmn2r67 UTSW 7 85155889 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAACCATAGTCTTGCCTTTG -3'
(R):5'- GCCATTGCTTTCACTGTGGC -3'

Sequencing Primer
(F):5'- CCTTTGGTGCTATGGTAGACAG -3'
(R):5'- AAGAATGAGGTGGCTGCTTC -3'
Posted On2016-09-06