Incidental Mutation 'R5401:Asna1'
ID429994
Institutional Source Beutler Lab
Gene Symbol Asna1
Ensembl Gene ENSMUSG00000052456
Gene NamearsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
SynonymsArsA, 1810048H22Rik
MMRRC Submission 042972-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85017931-85025281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85018544 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 298 (I298N)
Ref Sequence ENSEMBL: ENSMUSP00000065337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059072] [ENSMUST00000064314] [ENSMUST00000209322] [ENSMUST00000209421]
Predicted Effect probably benign
Transcript: ENSMUST00000059072
SMART Domains Protein: ENSMUSP00000053408
Gene: ENSMUSG00000052819

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 5.8e-118 PFAM
low complexity region 340 352 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 428 447 N/A INTRINSIC
low complexity region 457 479 N/A INTRINSIC
low complexity region 484 501 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000064314
AA Change: I298N

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065337
Gene: ENSMUSG00000052456
AA Change: I298N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:ArsA_ATPase 37 340 2.2e-127 PFAM
Pfam:CbiA 39 311 5.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209322
Predicted Effect probably benign
Transcript: ENSMUST00000209421
Predicted Effect probably benign
Transcript: ENSMUST00000209834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211702
Meta Mutation Damage Score 0.3888 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents the human homolog of the bacterial arsA gene, encoding the arsenite-stimulated ATPase component of the arsenite transporter responsible for resistance to arsenicals. This protein is also a central component of a transmembrane domain (TMD) recognition complex (TRC) that is involved in the post-translational delivery of tail-anchored (TA) proteins from the cytosol to the endoplasmic reticulum (ER). It recognizes and selectively binds the TMD of TA proteins in the cytosol, and delivers them to the ER for insertion. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Camkk2 T A 5: 122,746,335 D341V probably damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Cracr2b A G 7: 141,466,223 *395W probably null Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fndc8 T G 11: 82,897,850 S169A possibly damaging Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Kctd19 C T 8: 105,382,985 V942I probably benign Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Phf21a C A 2: 92,351,752 T342K possibly damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Plcz1 G T 6: 139,993,052 probably null Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srrm1 A G 4: 135,324,069 probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tsc1 C A 2: 28,686,908 S1073* probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Vmn2r67 A T 7: 85,136,557 Y747N probably damaging Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zswim2 C T 2: 83,925,245 G104E possibly damaging Het
Other mutations in Asna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Asna1 APN 8 85018556 missense possibly damaging 0.64
R0012:Asna1 UTSW 8 85025096 splice site probably benign
R0378:Asna1 UTSW 8 85025264 start codon destroyed probably null
R0504:Asna1 UTSW 8 85018607 missense probably damaging 1.00
R1188:Asna1 UTSW 8 85019793 missense probably damaging 1.00
R2001:Asna1 UTSW 8 85025160 missense probably damaging 0.96
R2029:Asna1 UTSW 8 85019774 nonsense probably null
R2264:Asna1 UTSW 8 85025258 unclassified probably benign
R2511:Asna1 UTSW 8 85019766 missense possibly damaging 0.79
R4676:Asna1 UTSW 8 85018873 missense probably benign 0.01
R6465:Asna1 UTSW 8 85018565 missense probably benign 0.01
R7378:Asna1 UTSW 8 85019863 missense probably benign 0.24
R8029:Asna1 UTSW 8 85019827 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGTAAATCCAGGGATGGC -3'
(R):5'- CTGTCTTGTGCCCTACAGGAAC -3'

Sequencing Primer
(F):5'- TGTCAGGCTTCCCAGTTGAGC -3'
(R):5'- CAGACAACGTTCATCTGTGTG -3'
Posted On2016-09-06