Incidental Mutation 'R5401:Kctd19'
ID429995
Institutional Source Beutler Lab
Gene Symbol Kctd19
Ensembl Gene ENSMUSG00000051648
Gene Namepotassium channel tetramerisation domain containing 19
Synonyms4922504H04Rik
MMRRC Submission 042972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105382807-105413502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105382985 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 942 (V942I)
Ref Sequence ENSEMBL: ENSMUSP00000050687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000167294] [ENSMUST00000168196] [ENSMUST00000214056]
Predicted Effect probably benign
Transcript: ENSMUST00000014927
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063071
AA Change: V942I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648
AA Change: V942I

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160191
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161672
Predicted Effect probably benign
Transcript: ENSMUST00000167294
AA Change: V919I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648
AA Change: V919I

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000168196
AA Change: S136N
Predicted Effect probably benign
Transcript: ENSMUST00000214056
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Asna1 A T 8: 85,018,544 I298N possibly damaging Het
Camkk2 T A 5: 122,746,335 D341V probably damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Cracr2b A G 7: 141,466,223 *395W probably null Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fndc8 T G 11: 82,897,850 S169A possibly damaging Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Phf21a C A 2: 92,351,752 T342K possibly damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Plcz1 G T 6: 139,993,052 probably null Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srrm1 A G 4: 135,324,069 probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tsc1 C A 2: 28,686,908 S1073* probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Vmn2r67 A T 7: 85,136,557 Y747N probably damaging Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zswim2 C T 2: 83,925,245 G104E possibly damaging Het
Other mutations in Kctd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Kctd19 APN 8 105388463 critical splice donor site probably null
IGL01546:Kctd19 APN 8 105386962 missense probably benign
IGL01786:Kctd19 APN 8 105390304 missense probably benign 0.03
IGL01964:Kctd19 APN 8 105388525 missense probably damaging 0.99
IGL02275:Kctd19 APN 8 105396374 missense probably damaging 0.99
IGL02479:Kctd19 APN 8 105384768 missense probably damaging 1.00
IGL03124:Kctd19 APN 8 105387070 missense possibly damaging 0.48
R0003:Kctd19 UTSW 8 105395361 missense probably damaging 0.99
R1183:Kctd19 UTSW 8 105382966 missense probably benign
R1388:Kctd19 UTSW 8 105392051 missense probably null 0.93
R1491:Kctd19 UTSW 8 105387062 missense possibly damaging 0.60
R1517:Kctd19 UTSW 8 105395376 missense probably damaging 1.00
R1540:Kctd19 UTSW 8 105387879 missense probably damaging 0.96
R1582:Kctd19 UTSW 8 105395460 missense probably damaging 1.00
R1964:Kctd19 UTSW 8 105388470 missense probably damaging 0.98
R1996:Kctd19 UTSW 8 105395300 missense probably null 1.00
R2129:Kctd19 UTSW 8 105385172 missense probably damaging 0.98
R2281:Kctd19 UTSW 8 105387266 missense probably benign 0.00
R3767:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R3768:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R4285:Kctd19 UTSW 8 105382949 unclassified probably benign
R4621:Kctd19 UTSW 8 105396471 missense probably damaging 1.00
R4701:Kctd19 UTSW 8 105390429 missense possibly damaging 0.76
R4969:Kctd19 UTSW 8 105396327 splice site probably null
R5070:Kctd19 UTSW 8 105391999 missense probably damaging 1.00
R5582:Kctd19 UTSW 8 105408443 missense probably damaging 1.00
R5783:Kctd19 UTSW 8 105386980 missense probably benign
R6056:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6057:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6269:Kctd19 UTSW 8 105395360 missense possibly damaging 0.96
R6273:Kctd19 UTSW 8 105385485 missense probably benign
R6631:Kctd19 UTSW 8 105385328 critical splice donor site probably null
R7298:Kctd19 UTSW 8 105382984 missense probably benign 0.01
R7474:Kctd19 UTSW 8 105392032 missense probably benign 0.25
R7540:Kctd19 UTSW 8 105386935 missense probably benign 0.00
R8059:Kctd19 UTSW 8 105396351 missense probably benign 0.02
Z1088:Kctd19 UTSW 8 105385335 missense probably benign 0.02
Z1176:Kctd19 UTSW 8 105385136 missense probably damaging 1.00
Z1177:Kctd19 UTSW 8 105388517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTGACACTCTGTTTTCTC -3'
(R):5'- TTCCCTGCTCAGATAAGGGAG -3'

Sequencing Primer
(F):5'- GTTTTCTCAGAGAAGAAATCTAGGC -3'
(R):5'- GAGCACCCCTCACACGGAG -3'
Posted On2016-09-06