Incidental Mutation 'R5401:Fndc8'
ID430005
Institutional Source Beutler Lab
Gene Symbol Fndc8
Ensembl Gene ENSMUSG00000018844
Gene Namefibronectin type III domain containing 8
Synonyms
MMRRC Submission 042972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82892124-82900801 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 82897850 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 169 (S169A)
Ref Sequence ENSEMBL: ENSMUSP00000018988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018988] [ENSMUST00000103213]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018988
AA Change: S169A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018988
Gene: ENSMUSG00000018844
AA Change: S169A

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
FN3 176 264 9.48e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103213
SMART Domains Protein: ENSMUSP00000099502
Gene: ENSMUSG00000020692

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NLE 17 77 3.6e-15 PFAM
WD40 103 142 5.22e-12 SMART
WD40 145 184 1.48e-11 SMART
WD40 188 232 1.66e-5 SMART
WD40 235 273 3.11e-10 SMART
WD40 276 357 1.14e-3 SMART
WD40 361 400 8.81e-10 SMART
WD40 403 442 1.69e-11 SMART
WD40 445 484 9.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140318
Predicted Effect probably benign
Transcript: ENSMUST00000167196
Meta Mutation Damage Score 0.0741 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Asna1 A T 8: 85,018,544 I298N possibly damaging Het
Camkk2 T A 5: 122,746,335 D341V probably damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Cracr2b A G 7: 141,466,223 *395W probably null Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Kctd19 C T 8: 105,382,985 V942I probably benign Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Phf21a C A 2: 92,351,752 T342K possibly damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Plcz1 G T 6: 139,993,052 probably null Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srrm1 A G 4: 135,324,069 probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tsc1 C A 2: 28,686,908 S1073* probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Vmn2r67 A T 7: 85,136,557 Y747N probably damaging Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zswim2 C T 2: 83,925,245 G104E possibly damaging Het
Other mutations in Fndc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02392:Fndc8 APN 11 82898603 missense probably damaging 1.00
R0066:Fndc8 UTSW 11 82897572 missense probably benign 0.38
R0066:Fndc8 UTSW 11 82897572 missense probably benign 0.38
R1827:Fndc8 UTSW 11 82899529 missense probably damaging 0.97
R2179:Fndc8 UTSW 11 82898754 missense probably damaging 1.00
R4504:Fndc8 UTSW 11 82892400 missense probably benign 0.21
R5889:Fndc8 UTSW 11 82898729 missense probably damaging 0.99
R5960:Fndc8 UTSW 11 82897572 missense probably benign 0.15
R6793:Fndc8 UTSW 11 82897586 missense probably damaging 1.00
R6798:Fndc8 UTSW 11 82892391 missense probably benign
R7210:Fndc8 UTSW 11 82897866 missense probably damaging 0.99
R7224:Fndc8 UTSW 11 82892325 missense probably benign 0.05
R7341:Fndc8 UTSW 11 82898777 missense possibly damaging 0.81
R7576:Fndc8 UTSW 11 82897574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCGTCCACTCTGATGAACC -3'
(R):5'- GTCAGAACACGCGGGTTATTC -3'

Sequencing Primer
(F):5'- AATAGCAGCTTCTTTGCCGG -3'
(R):5'- GCGGGTTATTCCTCCACAAAAC -3'
Posted On2016-09-06