Incidental Mutation 'R5401:Sh3bp5'
ID430014
Institutional Source Beutler Lab
Gene Symbol Sh3bp5
Ensembl Gene ENSMUSG00000021892
Gene NameSH3-domain binding protein 5 (BTK-associated)
SynonymsSab
MMRRC Submission 042972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R5401 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31359880-31436078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31377495 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 265 (R265L)
Ref Sequence ENSEMBL: ENSMUSP00000117152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091903] [ENSMUST00000100730] [ENSMUST00000140002]
Predicted Effect probably benign
Transcript: ENSMUST00000091903
AA Change: R265L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089517
Gene: ENSMUSG00000021892
AA Change: R265L

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.2e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100730
AA Change: R263L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098296
Gene: ENSMUSG00000021892
AA Change: R263L

DomainStartEndE-ValueType
Pfam:SH3BP5 60 274 5.5e-95 PFAM
low complexity region 321 333 N/A INTRINSIC
low complexity region 405 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140002
AA Change: R265L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117152
Gene: ENSMUSG00000021892
AA Change: R265L

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.3e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147586
Meta Mutation Damage Score 0.2831 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 40,051,042 noncoding transcript Het
1700025H01Rik G T 16: 30,199,983 noncoding transcript Het
2210016F16Rik C A 13: 58,382,591 A202S probably benign Het
2410141K09Rik T C 13: 66,431,663 R254G probably benign Het
9330159F19Rik T C 10: 29,225,140 V503A probably benign Het
Acacb A G 5: 114,209,853 N995S possibly damaging Het
Anapc4 A G 5: 52,863,649 K630R probably benign Het
Ankrd13a A C 5: 114,792,173 Q206H probably damaging Het
Ano10 A T 9: 122,261,290 L319Q probably damaging Het
Asna1 A T 8: 85,018,544 I298N possibly damaging Het
Camkk2 T A 5: 122,746,335 D341V probably damaging Het
Ccdc88a A G 11: 29,463,279 I606V probably benign Het
Cdv3 G T 9: 103,365,117 probably benign Het
Cep97 A G 16: 55,924,952 V155A probably benign Het
Cmya5 T C 13: 93,091,968 E2204G probably damaging Het
Cracr2b A G 7: 141,466,223 *395W probably null Het
Defa27 A G 8: 21,315,694 E50G possibly damaging Het
Dnah7a A G 1: 53,631,653 I480T probably benign Het
Ep400 C A 5: 110,683,171 D2210Y unknown Het
Fam170a T A 18: 50,280,551 S28T probably benign Het
Fancc C A 13: 63,402,953 K18N probably damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fndc8 T G 11: 82,897,850 S169A possibly damaging Het
Herc1 T C 9: 66,502,056 Y4688H probably damaging Het
Ighv11-2 A T 12: 114,048,339 D85E possibly damaging Het
Kat14 T C 2: 144,389,260 F196L possibly damaging Het
Kctd19 C T 8: 105,382,985 V942I probably benign Het
Llgl1 A G 11: 60,706,471 S249G probably benign Het
Map1a T C 2: 121,299,672 V323A probably damaging Het
Olfr734 C A 14: 50,320,109 C242F probably damaging Het
Phf21a C A 2: 92,351,752 T342K possibly damaging Het
Piezo2 T A 18: 63,084,740 D1122V possibly damaging Het
Pklr A G 3: 89,141,866 Y173C probably damaging Het
Plcz1 G T 6: 139,993,052 probably null Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prom1 A T 5: 44,000,805 Y845N probably damaging Het
Ret A T 6: 118,181,975 S159T probably benign Het
Rfx1 C A 8: 84,066,376 probably null Het
Scp2 A T 4: 108,144,779 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smad5 T C 13: 56,727,469 F157L probably benign Het
Smarcc2 C A 10: 128,465,504 D210E probably damaging Het
Sptlc3 T C 2: 139,636,723 L534P possibly damaging Het
Srrm1 A G 4: 135,324,069 probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Sugct T A 13: 16,857,870 Q432H probably damaging Het
Tex9 A T 9: 72,486,778 probably null Het
Tsc1 C A 2: 28,686,908 S1073* probably null Het
Vmn1r72 T C 7: 11,669,916 S202G probably damaging Het
Vmn2r55 A G 7: 12,651,944 V703A probably benign Het
Vmn2r67 A T 7: 85,136,557 Y747N probably damaging Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zswim2 C T 2: 83,925,245 G104E possibly damaging Het
Other mutations in Sh3bp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Sh3bp5 APN 14 31379390 nonsense probably null
IGL02828:Sh3bp5 APN 14 31434149 splice site probably benign
R1925:Sh3bp5 UTSW 14 31435923 missense probably benign
R2511:Sh3bp5 UTSW 14 31411629 missense probably damaging 1.00
R4798:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R4799:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5303:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5306:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5307:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5308:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5400:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5402:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5421:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5422:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5496:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5498:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5500:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5687:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5688:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5724:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5762:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5765:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5862:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5938:Sh3bp5 UTSW 14 31387834 missense possibly damaging 0.65
R5940:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5941:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R6516:Sh3bp5 UTSW 14 31375672 missense possibly damaging 0.84
R6935:Sh3bp5 UTSW 14 31379516 missense probably damaging 0.96
R7309:Sh3bp5 UTSW 14 31378289 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CAGCGCTCACATTCATCTGTG -3'
(R):5'- ACATTGAATGGGGAGCCATG -3'

Sequencing Primer
(F):5'- CATTCATCTGTGATGGGCAAAG -3'
(R):5'- GTGAAAGTCACTGGATCCTTCTCTAG -3'
Posted On2016-09-06