Incidental Mutation 'R5401:Piezo2'
ID 430020
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Piezo2, 9030411M15Rik, Fam38b2, Fam38b, 9430028L06Rik
MMRRC Submission 042972-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5401 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 63143284-63520254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63217811 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1122 (D1122V)
Ref Sequence ENSEMBL: ENSMUSP00000040019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000047480
AA Change: D1122V

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: D1122V

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182233
AA Change: D890V

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: D890V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183217
AA Change: D1108V

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: D1108V

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Meta Mutation Damage Score 0.1185 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik A G 9: 39,962,338 (GRCm39) noncoding transcript Het
1700025H01Rik G T 16: 30,018,801 (GRCm39) noncoding transcript Het
9330159F19Rik T C 10: 29,101,136 (GRCm39) V503A probably benign Het
Acacb A G 5: 114,347,914 (GRCm39) N995S possibly damaging Het
Anapc4 A G 5: 53,020,991 (GRCm39) K630R probably benign Het
Ankrd13a A C 5: 114,930,234 (GRCm39) Q206H probably damaging Het
Ano10 A T 9: 122,090,356 (GRCm39) L319Q probably damaging Het
Camkk2 T A 5: 122,884,398 (GRCm39) D341V probably damaging Het
Ccdc88a A G 11: 29,413,279 (GRCm39) I606V probably benign Het
Cdv3 G T 9: 103,242,316 (GRCm39) probably benign Het
Cep97 A G 16: 55,745,315 (GRCm39) V155A probably benign Het
Cmya5 T C 13: 93,228,476 (GRCm39) E2204G probably damaging Het
Cracr2b A G 7: 141,046,136 (GRCm39) *395W probably null Het
Defa27 A G 8: 21,805,710 (GRCm39) E50G possibly damaging Het
Dnah7a A G 1: 53,670,812 (GRCm39) I480T probably benign Het
Ep400 C A 5: 110,831,037 (GRCm39) D2210Y unknown Het
Fam170a T A 18: 50,413,618 (GRCm39) S28T probably benign Het
Fancc C A 13: 63,550,767 (GRCm39) K18N probably damaging Het
Flt4 AC ACC 11: 49,541,861 (GRCm39) probably null Het
Fndc8 T G 11: 82,788,676 (GRCm39) S169A possibly damaging Het
Get3 A T 8: 85,745,173 (GRCm39) I298N possibly damaging Het
Herc1 T C 9: 66,409,338 (GRCm39) Y4688H probably damaging Het
Ighv11-2 A T 12: 114,011,959 (GRCm39) D85E possibly damaging Het
Kat14 T C 2: 144,231,180 (GRCm39) F196L possibly damaging Het
Kctd19 C T 8: 106,109,617 (GRCm39) V942I probably benign Het
Llgl1 A G 11: 60,597,297 (GRCm39) S249G probably benign Het
Map1a T C 2: 121,130,153 (GRCm39) V323A probably damaging Het
Or4m1 C A 14: 50,557,566 (GRCm39) C242F probably damaging Het
Phf21a C A 2: 92,182,097 (GRCm39) T342K possibly damaging Het
Pklr A G 3: 89,049,173 (GRCm39) Y173C probably damaging Het
Plcz1 G T 6: 139,938,778 (GRCm39) probably null Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Prom1 A T 5: 44,158,147 (GRCm39) Y845N probably damaging Het
Qng1 C A 13: 58,530,405 (GRCm39) A202S probably benign Het
Ret A T 6: 118,158,936 (GRCm39) S159T probably benign Het
Rfx1 C A 8: 84,793,005 (GRCm39) probably null Het
Scp2 A T 4: 108,001,976 (GRCm39) probably null Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Smad5 T C 13: 56,875,282 (GRCm39) F157L probably benign Het
Smarcc2 C A 10: 128,301,373 (GRCm39) D210E probably damaging Het
Sptlc3 T C 2: 139,478,643 (GRCm39) L534P possibly damaging Het
Srrm1 A G 4: 135,051,380 (GRCm39) probably benign Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Sugct T A 13: 17,032,455 (GRCm39) Q432H probably damaging Het
Tex9 A T 9: 72,394,060 (GRCm39) probably null Het
Tsc1 C A 2: 28,576,920 (GRCm39) S1073* probably null Het
Vmn1r72 T C 7: 11,403,843 (GRCm39) S202G probably damaging Het
Vmn2r55 A G 7: 12,385,871 (GRCm39) V703A probably benign Het
Vmn2r67 A T 7: 84,785,765 (GRCm39) Y747N probably damaging Het
Zcchc4 A G 5: 52,964,419 (GRCm39) I292V probably benign Het
Zfp998 T C 13: 66,579,722 (GRCm39) R254G probably benign Het
Zswim2 C T 2: 83,755,589 (GRCm39) G104E possibly damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63,250,770 (GRCm39) missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63,155,531 (GRCm39) missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63,203,101 (GRCm39) missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63,257,685 (GRCm39) missense probably benign 0.03
IGL01568:Piezo2 APN 18 63,163,463 (GRCm39) missense probably benign 0.28
IGL01653:Piezo2 APN 18 63,315,904 (GRCm39) splice site probably benign
IGL01674:Piezo2 APN 18 63,160,630 (GRCm39) missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63,216,241 (GRCm39) missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63,175,859 (GRCm39) missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63,225,915 (GRCm39) missense probably benign 0.10
IGL02183:Piezo2 APN 18 63,153,705 (GRCm39) missense probably benign 0.00
IGL02407:Piezo2 APN 18 63,279,915 (GRCm39) missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63,205,933 (GRCm39) missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63,165,995 (GRCm39) missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63,157,546 (GRCm39) missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63,207,730 (GRCm39) missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63,153,704 (GRCm39) missense probably benign 0.18
IGL02851:Piezo2 APN 18 63,153,704 (GRCm39) missense probably benign 0.18
IGL02972:Piezo2 APN 18 63,197,856 (GRCm39) splice site probably benign
IGL03011:Piezo2 APN 18 63,257,731 (GRCm39) missense probably benign 0.03
IGL03078:Piezo2 APN 18 63,203,146 (GRCm39) missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63,163,343 (GRCm39) splice site probably null
IGL03129:Piezo2 APN 18 63,248,043 (GRCm39) missense probably benign
IGL03143:Piezo2 APN 18 63,241,147 (GRCm39) missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63,144,669 (GRCm39) missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63,257,677 (GRCm39) missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63,186,133 (GRCm39) missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63,174,791 (GRCm39) missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63,144,609 (GRCm39) utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63,154,379 (GRCm39) missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63,160,775 (GRCm39) missense probably damaging 1.00
Piccolo UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
sopranino UTSW 18 63,157,537 (GRCm39) missense probably damaging 1.00
woodwind UTSW 18 63,257,713 (GRCm39) missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63,519,271 (GRCm39) splice site probably benign
PIT4802001:Piezo2 UTSW 18 63,157,540 (GRCm39) missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63,235,155 (GRCm39) missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63,157,562 (GRCm39) missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63,162,132 (GRCm39) missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63,235,245 (GRCm39) missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63,157,522 (GRCm39) missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63,160,615 (GRCm39) missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63,155,552 (GRCm39) missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63,155,497 (GRCm39) missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63,152,329 (GRCm39) missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63,174,794 (GRCm39) missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63,216,306 (GRCm39) missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63,148,873 (GRCm39) missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63,219,824 (GRCm39) missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63,154,325 (GRCm39) missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63,216,202 (GRCm39) missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63,277,990 (GRCm39) missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63,215,986 (GRCm39) missense probably benign 0.03
R1649:Piezo2 UTSW 18 63,250,743 (GRCm39) missense probably benign 0.34
R1741:Piezo2 UTSW 18 63,154,244 (GRCm39) missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63,257,713 (GRCm39) missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63,239,355 (GRCm39) missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63,241,158 (GRCm39) missense probably damaging 1.00
R1799:Piezo2 UTSW 18 63,165,911 (GRCm39) critical splice donor site probably null
R1868:Piezo2 UTSW 18 63,152,415 (GRCm39) missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63,247,031 (GRCm39) missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63,211,911 (GRCm39) missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1991:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1992:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1995:Piezo2 UTSW 18 63,211,852 (GRCm39) missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63,277,997 (GRCm39) missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63,192,815 (GRCm39) missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63,252,006 (GRCm39) missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63,214,805 (GRCm39) missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63,250,791 (GRCm39) missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63,247,112 (GRCm39) missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R2183:Piezo2 UTSW 18 63,239,345 (GRCm39) missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63,278,143 (GRCm39) missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63,278,143 (GRCm39) missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63,155,596 (GRCm39) missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63,378,695 (GRCm39) missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63,186,106 (GRCm39) missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63,279,914 (GRCm39) missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63,157,506 (GRCm39) nonsense probably null
R3016:Piezo2 UTSW 18 63,175,903 (GRCm39) missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63,214,864 (GRCm39) missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R3833:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R3968:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63,183,675 (GRCm39) missense probably benign
R4181:Piezo2 UTSW 18 63,257,801 (GRCm39) critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63,217,911 (GRCm39) missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63,257,801 (GRCm39) critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63,235,170 (GRCm39) missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63,247,134 (GRCm39) missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63,205,951 (GRCm39) missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63,219,699 (GRCm39) missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63,203,034 (GRCm39) missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63,163,472 (GRCm39) missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63,163,472 (GRCm39) missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63,278,025 (GRCm39) missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63,211,862 (GRCm39) missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63,290,333 (GRCm39) missense probably benign
R4961:Piezo2 UTSW 18 63,186,032 (GRCm39) splice site probably null
R4968:Piezo2 UTSW 18 63,278,042 (GRCm39) nonsense probably null
R4973:Piezo2 UTSW 18 63,207,751 (GRCm39) missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63,216,184 (GRCm39) missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63,157,607 (GRCm39) missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63,207,691 (GRCm39) missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63,163,480 (GRCm39) missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63,166,000 (GRCm39) missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63,197,802 (GRCm39) missense probably damaging 1.00
R5464:Piezo2 UTSW 18 63,278,176 (GRCm39) missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63,160,935 (GRCm39) missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63,144,792 (GRCm39) missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63,278,162 (GRCm39) missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63,250,768 (GRCm39) missense probably benign 0.25
R5677:Piezo2 UTSW 18 63,250,767 (GRCm39) missense possibly damaging 0.94
R5792:Piezo2 UTSW 18 63,279,927 (GRCm39) missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63,160,972 (GRCm39) missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63,247,005 (GRCm39) missense probably benign 0.22
R6036:Piezo2 UTSW 18 63,248,019 (GRCm39) nonsense probably null
R6036:Piezo2 UTSW 18 63,248,019 (GRCm39) nonsense probably null
R6073:Piezo2 UTSW 18 63,145,716 (GRCm39) missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63,290,281 (GRCm39) nonsense probably null
R6255:Piezo2 UTSW 18 63,254,341 (GRCm39) missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63,250,749 (GRCm39) missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63,239,364 (GRCm39) missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63,219,678 (GRCm39) missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63,174,734 (GRCm39) missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63,239,342 (GRCm39) missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63,154,399 (GRCm39) missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63,154,333 (GRCm39) missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63,165,960 (GRCm39) nonsense probably null
R6855:Piezo2 UTSW 18 63,223,950 (GRCm39) critical splice donor site probably null
R6927:Piezo2 UTSW 18 63,166,057 (GRCm39) missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63,216,032 (GRCm39) critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63,278,181 (GRCm39) nonsense probably null
R7162:Piezo2 UTSW 18 63,257,780 (GRCm39) missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63,241,101 (GRCm39) missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63,150,590 (GRCm39) splice site probably null
R7395:Piezo2 UTSW 18 63,160,634 (GRCm39) missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63,157,543 (GRCm39) missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63,145,794 (GRCm39) missense probably benign
R7517:Piezo2 UTSW 18 63,215,996 (GRCm39) missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63,186,081 (GRCm39) missense probably benign 0.01
R7612:Piezo2 UTSW 18 63,175,610 (GRCm39) missense probably benign 0.12
R7829:Piezo2 UTSW 18 63,246,947 (GRCm39) critical splice donor site probably null
R7835:Piezo2 UTSW 18 63,216,016 (GRCm39) missense probably benign 0.12
R8014:Piezo2 UTSW 18 63,216,271 (GRCm39) missense probably benign 0.02
R8055:Piezo2 UTSW 18 63,175,882 (GRCm39) missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63,163,537 (GRCm39) missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63,208,801 (GRCm39) missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63,145,857 (GRCm39) missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63,224,069 (GRCm39) missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63,217,759 (GRCm39) missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63,224,069 (GRCm39) missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63,178,611 (GRCm39) missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63,279,873 (GRCm39) missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63,225,971 (GRCm39) nonsense probably null
R8708:Piezo2 UTSW 18 63,226,086 (GRCm39) missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63,242,956 (GRCm39) missense probably benign
R8727:Piezo2 UTSW 18 63,242,956 (GRCm39) missense probably benign
R8810:Piezo2 UTSW 18 63,248,034 (GRCm39) missense probably benign 0.41
R8900:Piezo2 UTSW 18 63,248,096 (GRCm39) missense probably benign 0.04
R9037:Piezo2 UTSW 18 63,225,902 (GRCm39) missense probably benign 0.31
R9079:Piezo2 UTSW 18 63,157,537 (GRCm39) missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63,208,790 (GRCm39) missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63,163,450 (GRCm39) missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63,178,589 (GRCm39) missense probably benign 0.00
R9125:Piezo2 UTSW 18 63,178,589 (GRCm39) missense probably benign 0.00
R9171:Piezo2 UTSW 18 63,178,550 (GRCm39) missense probably benign 0.04
R9194:Piezo2 UTSW 18 63,250,815 (GRCm39) missense probably benign 0.03
R9203:Piezo2 UTSW 18 63,290,302 (GRCm39) missense probably benign 0.00
R9209:Piezo2 UTSW 18 63,154,372 (GRCm39) missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63,208,868 (GRCm39) missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63,163,450 (GRCm39) missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63,208,790 (GRCm39) missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63,157,637 (GRCm39) missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63,162,156 (GRCm39) missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63,166,033 (GRCm39) missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63,235,236 (GRCm39) missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63,166,033 (GRCm39) missense possibly damaging 0.67
R9607:Piezo2 UTSW 18 63,519,347 (GRCm39) start gained probably benign
R9608:Piezo2 UTSW 18 63,280,016 (GRCm39) missense probably benign 0.09
R9617:Piezo2 UTSW 18 63,248,108 (GRCm39) missense probably benign 0.43
R9624:Piezo2 UTSW 18 63,197,767 (GRCm39) missense possibly damaging 0.88
X0017:Piezo2 UTSW 18 63,160,657 (GRCm39) missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63,183,681 (GRCm39) missense probably benign 0.43
X0060:Piezo2 UTSW 18 63,150,648 (GRCm39) missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63,203,065 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAATCACAAACTGGAGTTGGGC -3'
(R):5'- GCCAAACGACGATGGAATTAC -3'

Sequencing Primer
(F):5'- CTGGAGTTGGGCAATGAACC -3'
(R):5'- CACAGAGCCTTTAATGTACACAGATG -3'
Posted On 2016-09-06