Incidental Mutation 'R5402:Or4s2b'
ID 430027
Institutional Source Beutler Lab
Gene Symbol Or4s2b
Ensembl Gene ENSMUSG00000060827
Gene Name olfactory receptor family 4 subfamily S member 2B
Synonyms MOR230-9, Olfr1194-ps1, MOR226-1, GA_x6K02T2Q125-50158288-50158818, Olfr1193, GA_x6K02T2Q125-50154044-50154826
MMRRC Submission 042973-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R5402 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 88508201-88509157 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88508492 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 98 (S98T)
Ref Sequence ENSEMBL: ENSMUSP00000080399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081697] [ENSMUST00000099818] [ENSMUST00000213545] [ENSMUST00000213893] [ENSMUST00000216767]
AlphaFold A2AV13
Predicted Effect possibly damaging
Transcript: ENSMUST00000081697
AA Change: S98T

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080399
Gene: ENSMUSG00000060827
AA Change: S98T

DomainStartEndE-ValueType
Pfam:7tm_4 36 310 7.5e-51 PFAM
Pfam:7tm_1 46 292 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099818
SMART Domains Protein: ENSMUSP00000097406
Gene: ENSMUSG00000075121

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 32 300 1.6e-5 PFAM
Pfam:7tm_1 39 285 5.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213545
Predicted Effect probably benign
Transcript: ENSMUST00000213893
AA Change: S91T

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216767
AA Change: S91T

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217271
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,607,834 (GRCm39) D4079E probably benign Het
Bcar1 T C 8: 112,440,962 (GRCm39) D344G probably damaging Het
Car9 A G 4: 43,510,213 (GRCm39) N265S probably damaging Het
Ccr7 A G 11: 99,036,560 (GRCm39) S121P possibly damaging Het
Cgnl1 A G 9: 71,536,603 (GRCm39) L1278P probably damaging Het
Chst9 A T 18: 15,585,872 (GRCm39) S230R probably damaging Het
Cped1 G A 6: 22,143,951 (GRCm39) V566M probably benign Het
Csf2 A T 11: 54,138,489 (GRCm39) Y117* probably null Het
Cwf19l1 C T 19: 44,121,524 (GRCm39) probably null Het
Cyp2d34 C T 15: 82,503,287 (GRCm39) G69D probably damaging Het
Dync2h1 A T 9: 7,114,949 (GRCm39) V170E probably damaging Het
Ehbp1l1 T A 19: 5,766,348 (GRCm39) T388S possibly damaging Het
Etfa T C 9: 55,362,023 (GRCm39) I329M probably benign Het
Flt4 AC ACC 11: 49,541,861 (GRCm39) probably null Het
Fmnl2 G A 2: 53,018,794 (GRCm39) V1078I probably damaging Het
Fnip2 A G 3: 79,388,250 (GRCm39) L797P possibly damaging Het
Gmeb2 A T 2: 180,897,750 (GRCm39) probably null Het
Greb1l A G 18: 10,537,169 (GRCm39) T1045A probably benign Het
Hapln1 A G 13: 89,753,530 (GRCm39) N232S probably benign Het
Hibadh A T 6: 52,523,965 (GRCm39) M311K probably benign Het
Hus1 C T 11: 8,960,240 (GRCm39) probably null Het
Il31ra T C 13: 112,660,669 (GRCm39) E640G probably benign Het
L3mbtl4 T C 17: 68,762,769 (GRCm39) F101L probably damaging Het
Lbr A T 1: 181,647,526 (GRCm39) M417K probably benign Het
Lrig3 T G 10: 125,844,609 (GRCm39) L691R probably damaging Het
Mcm3ap T A 10: 76,319,148 (GRCm39) F792Y probably benign Het
Mst1 T C 9: 107,961,408 (GRCm39) probably null Het
Nova2 C A 7: 18,692,371 (GRCm39) T500K probably damaging Het
Nxph4 A T 10: 127,362,133 (GRCm39) C253S probably damaging Het
Or2t1 T C 14: 14,328,878 (GRCm38) Y256H probably damaging Het
Pcdhga3 G A 18: 37,808,747 (GRCm39) R400Q probably benign Het
Pidd1 C A 7: 141,018,507 (GRCm39) A915S probably damaging Het
Plat T G 8: 23,262,738 (GRCm39) W148G probably damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Pramel27 G A 4: 143,578,225 (GRCm39) probably null Het
Ptdss1 A G 13: 67,081,663 (GRCm39) D31G possibly damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Samd8 A G 14: 21,825,236 (GRCm39) D64G probably damaging Het
Scgb1b20 A G 7: 33,072,656 (GRCm39) probably null Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc25a23 T C 17: 57,360,336 (GRCm39) I269V probably benign Het
Slc35f4 A T 14: 49,556,331 (GRCm39) S141T probably damaging Het
Srgap1 T C 10: 121,621,665 (GRCm39) M966V probably benign Het
Syne2 T A 12: 76,106,213 (GRCm39) V5526E probably damaging Het
Tcaf3 A G 6: 42,568,860 (GRCm39) S596P probably benign Het
Tg T A 15: 66,611,017 (GRCm39) I356N probably damaging Het
Ttc6 C T 12: 57,783,817 (GRCm39) R1759* probably null Het
Wdsub1 T C 2: 59,700,822 (GRCm39) N138D probably benign Het
Zfp1001 A G 2: 150,204,886 (GRCm39) I67V probably benign Het
Other mutations in Or4s2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01939:Or4s2b APN 2 88,509,077 (GRCm39) missense probably damaging 1.00
R0322:Or4s2b UTSW 2 88,509,011 (GRCm39) missense probably damaging 0.98
R0711:Or4s2b UTSW 2 88,509,018 (GRCm39) missense probably damaging 1.00
R1500:Or4s2b UTSW 2 88,508,219 (GRCm39) missense possibly damaging 0.73
R1610:Or4s2b UTSW 2 88,508,918 (GRCm39) nonsense probably null
R4380:Or4s2b UTSW 2 88,508,615 (GRCm39) missense possibly damaging 0.61
R4602:Or4s2b UTSW 2 88,508,523 (GRCm39) missense probably benign
R4602:Or4s2b UTSW 2 88,508,240 (GRCm39) missense probably benign 0.08
R4610:Or4s2b UTSW 2 88,508,523 (GRCm39) missense probably benign
R4610:Or4s2b UTSW 2 88,508,240 (GRCm39) missense probably benign 0.08
R4790:Or4s2b UTSW 2 88,508,731 (GRCm39) missense possibly damaging 0.73
R4803:Or4s2b UTSW 2 88,508,366 (GRCm39) missense probably benign 0.34
R5736:Or4s2b UTSW 2 88,508,985 (GRCm39) missense probably benign 0.00
R6896:Or4s2b UTSW 2 88,508,340 (GRCm39) missense probably damaging 1.00
R6998:Or4s2b UTSW 2 88,508,852 (GRCm39) missense probably benign 0.23
R7038:Or4s2b UTSW 2 88,509,085 (GRCm39) missense probably damaging 1.00
R8806:Or4s2b UTSW 2 88,508,955 (GRCm39) missense probably benign 0.01
R9285:Or4s2b UTSW 2 88,508,680 (GRCm39) missense probably damaging 1.00
X0022:Or4s2b UTSW 2 88,508,664 (GRCm39) missense probably benign 0.08
Z1088:Or4s2b UTSW 2 88,509,008 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTCTGCTAGGAAACCTCC -3'
(R):5'- ATTCGGTCCACAAAAGGGG -3'

Sequencing Primer
(F):5'- GGAAACCTCCTCATCATGTTGACAG -3'
(R):5'- GTAAGAAGCCACCGATCCATGTTC -3'
Posted On 2016-09-06