Incidental Mutation 'R5402:Gmeb2'
ID430029
Institutional Source Beutler Lab
Gene Symbol Gmeb2
Ensembl Gene ENSMUSG00000038705
Gene Nameglucocorticoid modulatory element binding protein 2
Synonyms
MMRRC Submission 042973-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R5402 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181251449-181288035 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 181255957 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049032] [ENSMUST00000130475] [ENSMUST00000130475] [ENSMUST00000141003] [ENSMUST00000141110]
Predicted Effect probably null
Transcript: ENSMUST00000049032
SMART Domains Protein: ENSMUSP00000037075
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
SAND 90 163 1.66e-42 SMART
coiled coil region 304 347 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 475 488 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123148
Predicted Effect probably null
Transcript: ENSMUST00000130475
SMART Domains Protein: ENSMUSP00000116479
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
SAND 90 163 1.66e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000130475
SMART Domains Protein: ENSMUSP00000116479
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
SAND 90 163 1.66e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141003
SMART Domains Protein: ENSMUSP00000116854
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:SAND 81 126 7.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141110
SMART Domains Protein: ENSMUSP00000115853
Gene: ENSMUSG00000038705

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of KDWK gene family. The product of this gene associates with GMEB1 protein, and the complex is essential for parvovirus DNA replication. Study of rat homolog implicates the role of this gene in modulation of transactivation by the glucocorticoid receptor bound to glucocorticoid response elements. This gene appears to use multiple polyadenylation sites. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,459,715 D4079E probably benign Het
Bcar1 T C 8: 111,714,330 D344G probably damaging Het
Car9 A G 4: 43,510,213 N265S probably damaging Het
Ccr7 A G 11: 99,145,734 S121P possibly damaging Het
Cgnl1 A G 9: 71,629,321 L1278P probably damaging Het
Chst9 A T 18: 15,452,815 S230R probably damaging Het
Cped1 G A 6: 22,143,952 V566M probably benign Het
Csf2 A T 11: 54,247,663 Y117* probably null Het
Cwf19l1 C T 19: 44,133,085 probably null Het
Cyp2d34 C T 15: 82,619,086 G69D probably damaging Het
Dync2h1 A T 9: 7,114,949 V170E probably damaging Het
Ehbp1l1 T A 19: 5,716,320 T388S possibly damaging Het
Etfa T C 9: 55,454,739 I329M probably benign Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fmnl2 G A 2: 53,128,782 V1078I probably damaging Het
Fnip2 A G 3: 79,480,943 L797P possibly damaging Het
Gm10130 A G 2: 150,362,966 I67V probably benign Het
Gm13103 G A 4: 143,851,655 probably null Het
Greb1l A G 18: 10,537,169 T1045A probably benign Het
Hapln1 A G 13: 89,605,411 N232S probably benign Het
Hibadh A T 6: 52,546,980 M311K probably benign Het
Hus1 C T 11: 9,010,240 probably null Het
Il31ra T C 13: 112,524,135 E640G probably benign Het
L3mbtl4 T C 17: 68,455,774 F101L probably damaging Het
Lbr A T 1: 181,819,961 M417K probably benign Het
Lrig3 T G 10: 126,008,740 L691R probably damaging Het
Mcm3ap T A 10: 76,483,314 F792Y probably benign Het
Mst1 T C 9: 108,084,209 probably null Het
Nova2 C A 7: 18,958,446 T500K probably damaging Het
Nxph4 A T 10: 127,526,264 C253S probably damaging Het
Olfr1193 T A 2: 88,678,148 S98T possibly damaging Het
Olfr31 T C 14: 14,328,878 Y256H probably damaging Het
Pcdhga3 G A 18: 37,675,694 R400Q probably benign Het
Pidd1 C A 7: 141,438,594 A915S probably damaging Het
Plat T G 8: 22,772,722 W148G probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ptdss1 A G 13: 66,933,599 D31G possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Samd8 A G 14: 21,775,168 D64G probably damaging Het
Scgb1b20 A G 7: 33,373,231 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc25a23 T C 17: 57,053,336 I269V probably benign Het
Slc35f4 A T 14: 49,318,874 S141T probably damaging Het
Srgap1 T C 10: 121,785,760 M966V probably benign Het
Syne2 T A 12: 76,059,439 V5526E probably damaging Het
Tcaf3 A G 6: 42,591,926 S596P probably benign Het
Tg T A 15: 66,739,168 I356N probably damaging Het
Ttc6 C T 12: 57,737,031 R1759* probably null Het
Wdsub1 T C 2: 59,870,478 N138D probably benign Het
Other mutations in Gmeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Gmeb2 APN 2 181259043 missense probably benign 0.18
IGL02882:Gmeb2 APN 2 181265883 missense probably damaging 0.98
R0437:Gmeb2 UTSW 2 181253973 missense possibly damaging 0.83
R1499:Gmeb2 UTSW 2 181255226 missense probably benign 0.01
R2064:Gmeb2 UTSW 2 181253970 missense probably benign 0.42
R2127:Gmeb2 UTSW 2 181259049 missense probably benign 0.21
R2517:Gmeb2 UTSW 2 181259026 missense probably benign 0.12
R3087:Gmeb2 UTSW 2 181255640 splice site probably benign
R4202:Gmeb2 UTSW 2 181253973 missense possibly damaging 0.83
R4470:Gmeb2 UTSW 2 181265145 intron probably null
R4936:Gmeb2 UTSW 2 181254246 missense probably benign 0.04
R5296:Gmeb2 UTSW 2 181255986 intron probably benign
R5708:Gmeb2 UTSW 2 181264989 missense probably damaging 1.00
R5934:Gmeb2 UTSW 2 181255574 missense possibly damaging 0.63
R7673:Gmeb2 UTSW 2 181260388 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTGGATCCTAAACCCAGC -3'
(R):5'- AGCTGCTGAAGTTGAATGATAGC -3'

Sequencing Primer
(F):5'- GTTGGATCCTAAACCCAGCTAGGATC -3'
(R):5'- TGCTGAAGTTGAATGATAGCTCAGAG -3'
Posted On2016-09-06