Incidental Mutation 'R5402:Ttc6'
ID430062
Institutional Source Beutler Lab
Gene Symbol Ttc6
Ensembl Gene ENSMUSG00000046782
Gene Nametetratricopeptide repeat domain 6
SynonymsEG639426, LOC217602, Gm9813
MMRRC Submission 042973-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R5402 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location57564113-57737928 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 57737031 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1759 (R1759*)
Ref Sequence ENSEMBL: ENSMUSP00000134273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172939]
Predicted Effect probably null
Transcript: ENSMUST00000172939
AA Change: R1759*
SMART Domains Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782
AA Change: R1759*

DomainStartEndE-ValueType
coiled coil region 18 42 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
low complexity region 188 212 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 486 495 N/A INTRINSIC
low complexity region 670 685 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
TPR 889 922 2e-4 SMART
TPR 957 989 2.36e1 SMART
TPR 990 1022 2.63e1 SMART
TPR 1023 1056 9.39e-1 SMART
TPR 1057 1090 3.78e-5 SMART
Blast:TPR 1126 1157 1e-11 BLAST
SEL1 1160 1192 3.39e1 SMART
TPR 1160 1194 4.44e1 SMART
TPR 1195 1228 7.87e0 SMART
Blast:TPR 1229 1262 1e-11 BLAST
TPR 1297 1330 1.24e0 SMART
SEL1 1341 1372 9.26e-1 SMART
TPR 1341 1374 3.45e-8 SMART
TPR 1375 1407 8.76e-1 SMART
TPR 1408 1441 1.45e-1 SMART
TPR 1442 1475 1.36e1 SMART
TPR 1476 1509 7.34e-3 SMART
TPR 1513 1546 1.01e0 SMART
TPR 1547 1580 2.55e-2 SMART
TPR 1581 1617 2.43e1 SMART
Blast:TPR 1618 1651 4e-12 BLAST
TPR 1652 1685 7.87e0 SMART
TPR 1686 1718 2.35e-1 SMART
SEL1 1719 1750 1.21e2 SMART
TPR 1719 1752 1.65e-5 SMART
TPR 1753 1786 1.66e-1 SMART
TPR 1787 1820 1.45e-1 SMART
TPR 1821 1854 3.27e0 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,459,715 D4079E probably benign Het
Bcar1 T C 8: 111,714,330 D344G probably damaging Het
Car9 A G 4: 43,510,213 N265S probably damaging Het
Ccr7 A G 11: 99,145,734 S121P possibly damaging Het
Cgnl1 A G 9: 71,629,321 L1278P probably damaging Het
Chst9 A T 18: 15,452,815 S230R probably damaging Het
Cped1 G A 6: 22,143,952 V566M probably benign Het
Csf2 A T 11: 54,247,663 Y117* probably null Het
Cwf19l1 C T 19: 44,133,085 probably null Het
Cyp2d34 C T 15: 82,619,086 G69D probably damaging Het
Dync2h1 A T 9: 7,114,949 V170E probably damaging Het
Ehbp1l1 T A 19: 5,716,320 T388S possibly damaging Het
Etfa T C 9: 55,454,739 I329M probably benign Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fmnl2 G A 2: 53,128,782 V1078I probably damaging Het
Fnip2 A G 3: 79,480,943 L797P possibly damaging Het
Gm10130 A G 2: 150,362,966 I67V probably benign Het
Gm13103 G A 4: 143,851,655 probably null Het
Gmeb2 A T 2: 181,255,957 probably null Het
Greb1l A G 18: 10,537,169 T1045A probably benign Het
Hapln1 A G 13: 89,605,411 N232S probably benign Het
Hibadh A T 6: 52,546,980 M311K probably benign Het
Hus1 C T 11: 9,010,240 probably null Het
Il31ra T C 13: 112,524,135 E640G probably benign Het
L3mbtl4 T C 17: 68,455,774 F101L probably damaging Het
Lbr A T 1: 181,819,961 M417K probably benign Het
Lrig3 T G 10: 126,008,740 L691R probably damaging Het
Mcm3ap T A 10: 76,483,314 F792Y probably benign Het
Mst1 T C 9: 108,084,209 probably null Het
Nova2 C A 7: 18,958,446 T500K probably damaging Het
Nxph4 A T 10: 127,526,264 C253S probably damaging Het
Olfr1193 T A 2: 88,678,148 S98T possibly damaging Het
Olfr31 T C 14: 14,328,878 Y256H probably damaging Het
Pcdhga3 G A 18: 37,675,694 R400Q probably benign Het
Pidd1 C A 7: 141,438,594 A915S probably damaging Het
Plat T G 8: 22,772,722 W148G probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ptdss1 A G 13: 66,933,599 D31G possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Samd8 A G 14: 21,775,168 D64G probably damaging Het
Scgb1b20 A G 7: 33,373,231 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc25a23 T C 17: 57,053,336 I269V probably benign Het
Slc35f4 A T 14: 49,318,874 S141T probably damaging Het
Srgap1 T C 10: 121,785,760 M966V probably benign Het
Syne2 T A 12: 76,059,439 V5526E probably damaging Het
Tcaf3 A G 6: 42,591,926 S596P probably benign Het
Tg T A 15: 66,739,168 I356N probably damaging Het
Wdsub1 T C 2: 59,870,478 N138D probably benign Het
Other mutations in Ttc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03278:Ttc6 APN 12 57622026 missense probably damaging 0.99
IGL02802:Ttc6 UTSW 12 57575868 missense probably benign 0.14
PIT4802001:Ttc6 UTSW 12 57725676 missense possibly damaging 0.89
R0698:Ttc6 UTSW 12 57673216 missense probably benign 0.04
R0988:Ttc6 UTSW 12 57688649 splice site probably benign
R1290:Ttc6 UTSW 12 57660413 missense probably benign 0.00
R1338:Ttc6 UTSW 12 57616369 missense probably benign 0.10
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1481:Ttc6 UTSW 12 57737130 missense probably damaging 1.00
R1488:Ttc6 UTSW 12 57649515 missense possibly damaging 0.66
R1558:Ttc6 UTSW 12 57686346 missense probably benign 0.14
R1570:Ttc6 UTSW 12 57674763 missense probably damaging 0.98
R1619:Ttc6 UTSW 12 57737668 missense possibly damaging 0.73
R1819:Ttc6 UTSW 12 57694500 critical splice donor site probably null
R1826:Ttc6 UTSW 12 57660247 missense probably benign 0.10
R1863:Ttc6 UTSW 12 57714095 missense probably benign 0.04
R1872:Ttc6 UTSW 12 57704552 critical splice donor site probably null
R1887:Ttc6 UTSW 12 57673258 missense probably benign 0.04
R1937:Ttc6 UTSW 12 57616323 missense probably benign 0.02
R2014:Ttc6 UTSW 12 57576217 missense possibly damaging 0.92
R2056:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2058:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2059:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2152:Ttc6 UTSW 12 57705552 missense probably damaging 0.98
R2179:Ttc6 UTSW 12 57673118 missense possibly damaging 0.62
R2275:Ttc6 UTSW 12 57702298 missense probably benign 0.01
R2432:Ttc6 UTSW 12 57622035 missense possibly damaging 0.79
R2474:Ttc6 UTSW 12 57575927 missense probably benign 0.37
R2853:Ttc6 UTSW 12 57576181 missense probably damaging 0.96
R3848:Ttc6 UTSW 12 57677146 missense probably damaging 0.97
R3853:Ttc6 UTSW 12 57728549 missense possibly damaging 0.88
R3950:Ttc6 UTSW 12 57649506 missense probably damaging 0.97
R3953:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3954:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3955:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3957:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R4135:Ttc6 UTSW 12 57632795 intron probably benign
R4387:Ttc6 UTSW 12 57643050 missense probably benign 0.00
R4577:Ttc6 UTSW 12 57576655 missense probably benign 0.22
R4747:Ttc6 UTSW 12 57674692 missense possibly damaging 0.86
R4779:Ttc6 UTSW 12 57729451 missense probably damaging 1.00
R4803:Ttc6 UTSW 12 57728505 missense probably damaging 1.00
R4871:Ttc6 UTSW 12 57702356 missense probably damaging 0.96
R4898:Ttc6 UTSW 12 57660240 missense probably benign 0.00
R4930:Ttc6 UTSW 12 57673823 critical splice donor site probably null
R4946:Ttc6 UTSW 12 57643140 missense probably benign 0.01
R5257:Ttc6 UTSW 12 57702275 missense possibly damaging 0.92
R5303:Ttc6 UTSW 12 57575820 missense possibly damaging 0.90
R5385:Ttc6 UTSW 12 57643035 splice site probably null
R5428:Ttc6 UTSW 12 57689834 missense probably null 0.98
R5436:Ttc6 UTSW 12 57674594 splice site probably null
R5646:Ttc6 UTSW 12 57576019 missense probably damaging 0.99
R5697:Ttc6 UTSW 12 57677214 missense probably benign 0.22
R5792:Ttc6 UTSW 12 57673204 missense possibly damaging 0.71
R5808:Ttc6 UTSW 12 57617611 missense possibly damaging 0.84
R5842:Ttc6 UTSW 12 57737016 missense probably damaging 1.00
R5935:Ttc6 UTSW 12 57673804 missense probably damaging 0.98
R6144:Ttc6 UTSW 12 57673100 missense possibly damaging 0.83
R6155:Ttc6 UTSW 12 57737616 missense possibly damaging 0.84
R6283:Ttc6 UTSW 12 57702262 missense possibly damaging 0.95
R6371:Ttc6 UTSW 12 57728463 missense possibly damaging 0.89
R6715:Ttc6 UTSW 12 57674770 critical splice donor site probably null
R6738:Ttc6 UTSW 12 57688640 missense probably damaging 0.99
R6795:Ttc6 UTSW 12 57704413 missense probably damaging 0.96
R6959:Ttc6 UTSW 12 57658142 splice site probably null
R7053:Ttc6 UTSW 12 57660532 missense probably benign 0.01
R7125:Ttc6 UTSW 12 57576339 missense probably benign 0.00
R7259:Ttc6 UTSW 12 57576184 missense probably benign 0.00
R7304:Ttc6 UTSW 12 57576051 missense probably damaging 0.96
R7369:Ttc6 UTSW 12 57672931 critical splice acceptor site probably null
R7409:Ttc6 UTSW 12 57696986 missense probably damaging 0.99
R7429:Ttc6 UTSW 12 57658102 missense probably benign 0.00
R7430:Ttc6 UTSW 12 57658102 missense probably benign 0.00
R7492:Ttc6 UTSW 12 57673136 missense probably benign 0.02
R7535:Ttc6 UTSW 12 57576519 missense probably benign 0.00
R7866:Ttc6 UTSW 12 57674649 missense probably damaging 0.97
R7901:Ttc6 UTSW 12 57688567 missense probably damaging 1.00
R7949:Ttc6 UTSW 12 57674649 missense probably damaging 0.97
R7984:Ttc6 UTSW 12 57688567 missense probably damaging 1.00
R8062:Ttc6 UTSW 12 57736978
X0021:Ttc6 UTSW 12 57576118 missense probably damaging 0.96
X0058:Ttc6 UTSW 12 57706851 missense probably damaging 0.99
Z1176:Ttc6 UTSW 12 57697375
Predicted Primers PCR Primer
(F):5'- TTGGAATGAAATGCCATCACGG -3'
(R):5'- ATCCCTGCAATCATCTTGACAG -3'

Sequencing Primer
(F):5'- ACGGCCTGCTTAGAAATCTG -3'
(R):5'- CTGCAATCATCTTGACAGGATTAC -3'
Posted On2016-09-06