Incidental Mutation 'R5402:Hapln1'
ID430066
Institutional Source Beutler Lab
Gene Symbol Hapln1
Ensembl Gene ENSMUSG00000021613
Gene Namehyaluronan and proteoglycan link protein 1
Synonymslink protein, LP-1, CLP, cartilage linking protein 1, Crtl1l, Crtl1
MMRRC Submission 042973-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5402 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location89539796-89611652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89605411 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 232 (N232S)
Ref Sequence ENSEMBL: ENSMUSP00000022108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022108]
Predicted Effect probably benign
Transcript: ENSMUST00000022108
AA Change: N232S

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022108
Gene: ENSMUSG00000021613
AA Change: N232S

DomainStartEndE-ValueType
IGv 58 143 3.48e-12 SMART
LINK 159 256 7.26e-61 SMART
LINK 260 353 8.35e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225678
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in cartilage development and delayed bone formation with short limbs and craniofacial anomalies. Mutants usually die as neonates due to respiratory failure, but some survive and develop dwarfism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,459,715 D4079E probably benign Het
Bcar1 T C 8: 111,714,330 D344G probably damaging Het
Car9 A G 4: 43,510,213 N265S probably damaging Het
Ccr7 A G 11: 99,145,734 S121P possibly damaging Het
Cgnl1 A G 9: 71,629,321 L1278P probably damaging Het
Chst9 A T 18: 15,452,815 S230R probably damaging Het
Cped1 G A 6: 22,143,952 V566M probably benign Het
Csf2 A T 11: 54,247,663 Y117* probably null Het
Cwf19l1 C T 19: 44,133,085 probably null Het
Cyp2d34 C T 15: 82,619,086 G69D probably damaging Het
Dync2h1 A T 9: 7,114,949 V170E probably damaging Het
Ehbp1l1 T A 19: 5,716,320 T388S possibly damaging Het
Etfa T C 9: 55,454,739 I329M probably benign Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fmnl2 G A 2: 53,128,782 V1078I probably damaging Het
Fnip2 A G 3: 79,480,943 L797P possibly damaging Het
Gm10130 A G 2: 150,362,966 I67V probably benign Het
Gm13103 G A 4: 143,851,655 probably null Het
Gmeb2 A T 2: 181,255,957 probably null Het
Greb1l A G 18: 10,537,169 T1045A probably benign Het
Hibadh A T 6: 52,546,980 M311K probably benign Het
Hus1 C T 11: 9,010,240 probably null Het
Il31ra T C 13: 112,524,135 E640G probably benign Het
L3mbtl4 T C 17: 68,455,774 F101L probably damaging Het
Lbr A T 1: 181,819,961 M417K probably benign Het
Lrig3 T G 10: 126,008,740 L691R probably damaging Het
Mcm3ap T A 10: 76,483,314 F792Y probably benign Het
Mst1 T C 9: 108,084,209 probably null Het
Nova2 C A 7: 18,958,446 T500K probably damaging Het
Nxph4 A T 10: 127,526,264 C253S probably damaging Het
Olfr1193 T A 2: 88,678,148 S98T possibly damaging Het
Olfr31 T C 14: 14,328,878 Y256H probably damaging Het
Pcdhga3 G A 18: 37,675,694 R400Q probably benign Het
Pidd1 C A 7: 141,438,594 A915S probably damaging Het
Plat T G 8: 22,772,722 W148G probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ptdss1 A G 13: 66,933,599 D31G possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Samd8 A G 14: 21,775,168 D64G probably damaging Het
Scgb1b20 A G 7: 33,373,231 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc25a23 T C 17: 57,053,336 I269V probably benign Het
Slc35f4 A T 14: 49,318,874 S141T probably damaging Het
Srgap1 T C 10: 121,785,760 M966V probably benign Het
Syne2 T A 12: 76,059,439 V5526E probably damaging Het
Tcaf3 A G 6: 42,591,926 S596P probably benign Het
Tg T A 15: 66,739,168 I356N probably damaging Het
Ttc6 C T 12: 57,737,031 R1759* probably null Het
Wdsub1 T C 2: 59,870,478 N138D probably benign Het
Other mutations in Hapln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Hapln1 APN 13 89608142 missense probably benign 0.00
IGL00494:Hapln1 APN 13 89605471 missense probably benign 0.04
IGL01865:Hapln1 APN 13 89601665 missense probably damaging 1.00
IGL02706:Hapln1 APN 13 89605459 missense possibly damaging 0.86
IGL02990:Hapln1 APN 13 89601606 missense probably benign 0.03
R0033:Hapln1 UTSW 13 89601813 missense probably benign 0.20
R0058:Hapln1 UTSW 13 89607878 missense probably benign 0.17
R0058:Hapln1 UTSW 13 89607878 missense probably benign 0.17
R0127:Hapln1 UTSW 13 89607869 missense probably benign 0.22
R0519:Hapln1 UTSW 13 89584716 start gained probably benign
R3862:Hapln1 UTSW 13 89605299 nonsense probably null
R3982:Hapln1 UTSW 13 89605441 missense probably benign
R4717:Hapln1 UTSW 13 89605460 missense probably benign 0.11
R4861:Hapln1 UTSW 13 89601452 missense possibly damaging 0.65
R4861:Hapln1 UTSW 13 89601452 missense possibly damaging 0.65
R4862:Hapln1 UTSW 13 89601452 missense possibly damaging 0.65
R4899:Hapln1 UTSW 13 89601650 missense possibly damaging 0.90
R5629:Hapln1 UTSW 13 89601515 missense probably damaging 0.98
R6019:Hapln1 UTSW 13 89608100 missense probably benign 0.45
Z1088:Hapln1 UTSW 13 89601498 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAACTTTCACGAGGCACGCC -3'
(R):5'- GCAAGATTCAAGAACATTTTGCCTC -3'

Sequencing Primer
(F):5'- CAGGCTTGTCTGGACCAG -3'
(R):5'- CCTTAAAGGATTGCTTTTTATTGCTG -3'
Posted On2016-09-06