Incidental Mutation 'R5402:Il31ra'
ID430067
Institutional Source Beutler Lab
Gene Symbol Il31ra
Ensembl Gene ENSMUSG00000050377
Gene Nameinterleukin 31 receptor A
SynonymsGLM-R, GPL
MMRRC Submission 042973-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5402 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112519898-112594360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112524135 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 640 (E640G)
Ref Sequence ENSEMBL: ENSMUSP00000058045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051756] [ENSMUST00000223752] [ENSMUST00000223819] [ENSMUST00000224510] [ENSMUST00000224576]
Predicted Effect probably benign
Transcript: ENSMUST00000051756
AA Change: E640G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000058045
Gene: ENSMUSG00000050377
AA Change: E640G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FN3 115 198 7.75e0 SMART
Blast:FN3 216 297 1e-40 BLAST
FN3 325 394 1.15e1 SMART
FN3 408 490 7.18e-3 SMART
low complexity region 508 522 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223577
Predicted Effect probably benign
Transcript: ENSMUST00000223752
Predicted Effect probably benign
Transcript: ENSMUST00000223819
Predicted Effect probably benign
Transcript: ENSMUST00000224510
AA Change: E559G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000224576
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the type I cytokine receptor family. This receptor, with homology to gp130, is expressed on monocytes, and is involved in IL-31 signaling via activation of STAT-3 and STAT-5. It functions either as a monomer, or as part of a receptor complex with oncostatin M receptor (OSMR). Several alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous null mice display no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,459,715 D4079E probably benign Het
Bcar1 T C 8: 111,714,330 D344G probably damaging Het
Car9 A G 4: 43,510,213 N265S probably damaging Het
Ccr7 A G 11: 99,145,734 S121P possibly damaging Het
Cgnl1 A G 9: 71,629,321 L1278P probably damaging Het
Chst9 A T 18: 15,452,815 S230R probably damaging Het
Cped1 G A 6: 22,143,952 V566M probably benign Het
Csf2 A T 11: 54,247,663 Y117* probably null Het
Cwf19l1 C T 19: 44,133,085 probably null Het
Cyp2d34 C T 15: 82,619,086 G69D probably damaging Het
Dync2h1 A T 9: 7,114,949 V170E probably damaging Het
Ehbp1l1 T A 19: 5,716,320 T388S possibly damaging Het
Etfa T C 9: 55,454,739 I329M probably benign Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fmnl2 G A 2: 53,128,782 V1078I probably damaging Het
Fnip2 A G 3: 79,480,943 L797P possibly damaging Het
Gm10130 A G 2: 150,362,966 I67V probably benign Het
Gm13103 G A 4: 143,851,655 probably null Het
Gmeb2 A T 2: 181,255,957 probably null Het
Greb1l A G 18: 10,537,169 T1045A probably benign Het
Hapln1 A G 13: 89,605,411 N232S probably benign Het
Hibadh A T 6: 52,546,980 M311K probably benign Het
Hus1 C T 11: 9,010,240 probably null Het
L3mbtl4 T C 17: 68,455,774 F101L probably damaging Het
Lbr A T 1: 181,819,961 M417K probably benign Het
Lrig3 T G 10: 126,008,740 L691R probably damaging Het
Mcm3ap T A 10: 76,483,314 F792Y probably benign Het
Mst1 T C 9: 108,084,209 probably null Het
Nova2 C A 7: 18,958,446 T500K probably damaging Het
Nxph4 A T 10: 127,526,264 C253S probably damaging Het
Olfr1193 T A 2: 88,678,148 S98T possibly damaging Het
Olfr31 T C 14: 14,328,878 Y256H probably damaging Het
Pcdhga3 G A 18: 37,675,694 R400Q probably benign Het
Pidd1 C A 7: 141,438,594 A915S probably damaging Het
Plat T G 8: 22,772,722 W148G probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ptdss1 A G 13: 66,933,599 D31G possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Samd8 A G 14: 21,775,168 D64G probably damaging Het
Scgb1b20 A G 7: 33,373,231 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc25a23 T C 17: 57,053,336 I269V probably benign Het
Slc35f4 A T 14: 49,318,874 S141T probably damaging Het
Srgap1 T C 10: 121,785,760 M966V probably benign Het
Syne2 T A 12: 76,059,439 V5526E probably damaging Het
Tcaf3 A G 6: 42,591,926 S596P probably benign Het
Tg T A 15: 66,739,168 I356N probably damaging Het
Ttc6 C T 12: 57,737,031 R1759* probably null Het
Wdsub1 T C 2: 59,870,478 N138D probably benign Het
Other mutations in Il31ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Il31ra APN 13 112547478 missense possibly damaging 0.94
IGL00639:Il31ra APN 13 112549559 nonsense probably null
IGL01640:Il31ra APN 13 112531758 missense possibly damaging 0.58
IGL02009:Il31ra APN 13 112533867 missense probably damaging 0.98
IGL02431:Il31ra APN 13 112530296 missense probably damaging 1.00
IGL02675:Il31ra APN 13 112524352 missense probably benign 0.00
IGL02718:Il31ra APN 13 112530369 nonsense probably null
IGL03388:Il31ra APN 13 112546212 missense probably damaging 1.00
IGL03408:Il31ra APN 13 112525888 missense probably benign 0.21
R0482:Il31ra UTSW 13 112527481 missense possibly damaging 0.89
R0639:Il31ra UTSW 13 112525843 missense possibly damaging 0.95
R0905:Il31ra UTSW 13 112531673 missense probably damaging 1.00
R0948:Il31ra UTSW 13 112530378 missense possibly damaging 0.81
R1420:Il31ra UTSW 13 112531752 missense probably damaging 1.00
R1538:Il31ra UTSW 13 112547466 missense possibly damaging 0.91
R1776:Il31ra UTSW 13 112541239 missense probably damaging 0.97
R1931:Il31ra UTSW 13 112541222 missense probably damaging 1.00
R2006:Il31ra UTSW 13 112530356 missense probably damaging 1.00
R2134:Il31ra UTSW 13 112543888 missense possibly damaging 0.94
R3103:Il31ra UTSW 13 112530351 missense probably damaging 1.00
R4089:Il31ra UTSW 13 112551919 nonsense probably null
R4742:Il31ra UTSW 13 112523967 nonsense probably null
R4787:Il31ra UTSW 13 112527545 missense possibly damaging 0.82
R5154:Il31ra UTSW 13 112523997 missense possibly damaging 0.87
R5193:Il31ra UTSW 13 112524330 missense probably benign 0.34
R5743:Il31ra UTSW 13 112527487 missense possibly damaging 0.89
R5917:Il31ra UTSW 13 112546312 missense probably benign
R6126:Il31ra UTSW 13 112530374 missense probably damaging 1.00
R6414:Il31ra UTSW 13 112523907 missense possibly damaging 0.90
R6580:Il31ra UTSW 13 112551942 missense possibly damaging 0.90
R6727:Il31ra UTSW 13 112547368 missense probably damaging 1.00
R6783:Il31ra UTSW 13 112551988 critical splice acceptor site probably null
R6912:Il31ra UTSW 13 112549464 missense probably damaging 0.99
R6925:Il31ra UTSW 13 112527529 missense possibly damaging 0.56
R7187:Il31ra UTSW 13 112546311 missense probably benign 0.04
R7210:Il31ra UTSW 13 112549500 missense possibly damaging 0.95
R7236:Il31ra UTSW 13 112523905 makesense probably null
R7323:Il31ra UTSW 13 112551963 missense probably damaging 1.00
R7618:Il31ra UTSW 13 112551980 missense possibly damaging 0.66
R7783:Il31ra UTSW 13 112541251 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGAAATTCCCTGGTTGTCACTG -3'
(R):5'- ACTCTGGGGACACAGAAGAC -3'

Sequencing Primer
(F):5'- ATTCCCTGGTTGTCACTGAATTTTTC -3'
(R):5'- TGGTCCTAAAACCATGTCCCG -3'
Posted On2016-09-06