Incidental Mutation 'R5402:Slc35f4'
ID430072
Institutional Source Beutler Lab
Gene Symbol Slc35f4
Ensembl Gene ENSMUSG00000021852
Gene Namesolute carrier family 35, member F4
Synonyms
MMRRC Submission 042973-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5402 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location49298519-49526046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49318874 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 141 (S141T)
Ref Sequence ENSEMBL: ENSMUSP00000154089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074368] [ENSMUST00000123534] [ENSMUST00000138884] [ENSMUST00000146164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074368
AA Change: S141T

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073972
Gene: ENSMUSG00000021852
AA Change: S141T

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:SLC35F 216 435 7.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123534
AA Change: S141T

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122405
Gene: ENSMUSG00000021852
AA Change: S141T

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
transmembrane domain 217 234 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135254
Predicted Effect probably benign
Transcript: ENSMUST00000138884
AA Change: I24N

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000119007
Gene: ENSMUSG00000021852
AA Change: I24N

DomainStartEndE-ValueType
Pfam:EmrE 18 143 1e-12 PFAM
Pfam:EamA 57 135 8.4e-9 PFAM
Pfam:DUF914 68 314 4.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146164
AA Change: S141T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,459,715 D4079E probably benign Het
Bcar1 T C 8: 111,714,330 D344G probably damaging Het
Car9 A G 4: 43,510,213 N265S probably damaging Het
Ccr7 A G 11: 99,145,734 S121P possibly damaging Het
Cgnl1 A G 9: 71,629,321 L1278P probably damaging Het
Chst9 A T 18: 15,452,815 S230R probably damaging Het
Cped1 G A 6: 22,143,952 V566M probably benign Het
Csf2 A T 11: 54,247,663 Y117* probably null Het
Cwf19l1 C T 19: 44,133,085 probably null Het
Cyp2d34 C T 15: 82,619,086 G69D probably damaging Het
Dync2h1 A T 9: 7,114,949 V170E probably damaging Het
Ehbp1l1 T A 19: 5,716,320 T388S possibly damaging Het
Etfa T C 9: 55,454,739 I329M probably benign Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fmnl2 G A 2: 53,128,782 V1078I probably damaging Het
Fnip2 A G 3: 79,480,943 L797P possibly damaging Het
Gm10130 A G 2: 150,362,966 I67V probably benign Het
Gm13103 G A 4: 143,851,655 probably null Het
Gmeb2 A T 2: 181,255,957 probably null Het
Greb1l A G 18: 10,537,169 T1045A probably benign Het
Hapln1 A G 13: 89,605,411 N232S probably benign Het
Hibadh A T 6: 52,546,980 M311K probably benign Het
Hus1 C T 11: 9,010,240 probably null Het
Il31ra T C 13: 112,524,135 E640G probably benign Het
L3mbtl4 T C 17: 68,455,774 F101L probably damaging Het
Lbr A T 1: 181,819,961 M417K probably benign Het
Lrig3 T G 10: 126,008,740 L691R probably damaging Het
Mcm3ap T A 10: 76,483,314 F792Y probably benign Het
Mst1 T C 9: 108,084,209 probably null Het
Nova2 C A 7: 18,958,446 T500K probably damaging Het
Nxph4 A T 10: 127,526,264 C253S probably damaging Het
Olfr1193 T A 2: 88,678,148 S98T possibly damaging Het
Olfr31 T C 14: 14,328,878 Y256H probably damaging Het
Pcdhga3 G A 18: 37,675,694 R400Q probably benign Het
Pidd1 C A 7: 141,438,594 A915S probably damaging Het
Plat T G 8: 22,772,722 W148G probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ptdss1 A G 13: 66,933,599 D31G possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Samd8 A G 14: 21,775,168 D64G probably damaging Het
Scgb1b20 A G 7: 33,373,231 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc25a23 T C 17: 57,053,336 I269V probably benign Het
Srgap1 T C 10: 121,785,760 M966V probably benign Het
Syne2 T A 12: 76,059,439 V5526E probably damaging Het
Tcaf3 A G 6: 42,591,926 S596P probably benign Het
Tg T A 15: 66,739,168 I356N probably damaging Het
Ttc6 C T 12: 57,737,031 R1759* probably null Het
Wdsub1 T C 2: 59,870,478 N138D probably benign Het
Other mutations in Slc35f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Slc35f4 APN 14 49298877 missense probably benign 0.15
IGL01640:Slc35f4 APN 14 49318768 missense probably damaging 0.99
IGL01942:Slc35f4 APN 14 49525505 splice site probably benign
IGL01990:Slc35f4 APN 14 49304169 critical splice donor site probably null
IGL02097:Slc35f4 APN 14 49306246 missense probably damaging 1.00
IGL02803:Slc35f4 APN 14 49304257 missense probably benign 0.00
R0005:Slc35f4 UTSW 14 49322486 splice site probably benign
R0238:Slc35f4 UTSW 14 49304256 missense possibly damaging 0.78
R0238:Slc35f4 UTSW 14 49304256 missense possibly damaging 0.78
R0239:Slc35f4 UTSW 14 49304256 missense possibly damaging 0.78
R0239:Slc35f4 UTSW 14 49304256 missense possibly damaging 0.78
R0764:Slc35f4 UTSW 14 49306339 splice site probably benign
R1884:Slc35f4 UTSW 14 49313634 missense probably damaging 1.00
R1916:Slc35f4 UTSW 14 49303923 intron probably benign
R2047:Slc35f4 UTSW 14 49303572 intron probably benign
R2239:Slc35f4 UTSW 14 49306203 critical splice donor site probably null
R2380:Slc35f4 UTSW 14 49306203 critical splice donor site probably null
R4273:Slc35f4 UTSW 14 49304301 missense possibly damaging 0.81
R4420:Slc35f4 UTSW 14 49313577 unclassified probably benign
R4425:Slc35f4 UTSW 14 49318850 missense possibly damaging 0.85
R5261:Slc35f4 UTSW 14 49303489 intron probably benign
R5398:Slc35f4 UTSW 14 49298847 missense probably damaging 1.00
R6310:Slc35f4 UTSW 14 49322457 missense probably damaging 1.00
R6596:Slc35f4 UTSW 14 49525600 missense probably damaging 1.00
R6729:Slc35f4 UTSW 14 49318960 missense probably benign 0.16
R6864:Slc35f4 UTSW 14 49318853 missense possibly damaging 0.55
R7427:Slc35f4 UTSW 14 49298898 missense probably damaging 0.99
R7428:Slc35f4 UTSW 14 49298898 missense probably damaging 0.99
R7559:Slc35f4 UTSW 14 49304275 missense probably benign 0.03
R7596:Slc35f4 UTSW 14 49306209 missense probably damaging 1.00
R7722:Slc35f4 UTSW 14 49306274 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CATTGAACATGGAACCTACCTG -3'
(R):5'- ATCAGGCTTGTAGTTACACGC -3'

Sequencing Primer
(F):5'- GCTAGATGGCCGGAATAA -3'
(R):5'- GAAGCTGACACATCTGACTGCTC -3'
Posted On2016-09-06