Mutagenetix > Incidental Mutation

Incidental Mutation 'R5402:Tg'

430073

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000053469

Gene Name

thyroglobulin

Synonyms

Tgn

MMRRC Submission

042973-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R5402 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66670753-66850721 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66739168 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 356 (I356N)

Ref Sequence

ENSEMBL: ENSMUSP00000126454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000163495] [ENSMUST00000171045]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000065916
AA Change: I1975N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: I1975N

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
TY	50	97	5.9e-16	SMART
TY	118	165	5.59e-17	SMART
Pfam:Thyroglobulin_1	174	252	4e-9	PFAM
TY	317	363	4.36e-19	SMART
low complexity region	495	504	N/A	INTRINSIC
TY	617	662	3.58e-15	SMART
TY	684	730	1.47e-16	SMART
TY	880	926	1.51e-4	SMART
TY	1029	1078	1.21e-12	SMART
TY	1106	1150	7.56e-5	SMART
TY	1167	1215	7.26e-16	SMART
low complexity region	1244	1255	N/A	INTRINSIC
Pfam:GCC2_GCC3	1464	1509	2.7e-16	PFAM
TY	1519	1568	9.81e-13	SMART
Pfam:COesterase	2181	2717	8.4e-140	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163495

SMART Domains

Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

Domain	Start	End	E-Value	Type
TY	14	63	1.21e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169163

Predicted Effect

probably damaging
Transcript: ENSMUST00000171045
AA Change: I356N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469
AA Change: I356N

Domain	Start	End	E-Value	Type
internal_repeat_1	93	331	1.53e-6	PROSPERO
Pfam:COesterase	562	1098	2.1e-137	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172153

SMART Domains

Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

Domain	Start	End	E-Value	Type
Pfam:COesterase	313	849	6e-140	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,459,715	D4079E	probably benign	Het
Bcar1	T	C	8: 111,714,330	D344G	probably damaging	Het
Car9	A	G	4: 43,510,213	N265S	probably damaging	Het
Ccr7	A	G	11: 99,145,734	S121P	possibly damaging	Het
Cgnl1	A	G	9: 71,629,321	L1278P	probably damaging	Het
Chst9	A	T	18: 15,452,815	S230R	probably damaging	Het
Cped1	G	A	6: 22,143,952	V566M	probably benign	Het
Csf2	A	T	11: 54,247,663	Y117*	probably null	Het
Cwf19l1	C	T	19: 44,133,085		probably null	Het
Cyp2d34	C	T	15: 82,619,086	G69D	probably damaging	Het
Dync2h1	A	T	9: 7,114,949	V170E	probably damaging	Het
Ehbp1l1	T	A	19: 5,716,320	T388S	possibly damaging	Het
Etfa	T	C	9: 55,454,739	I329M	probably benign	Het
Flt4	AC	ACC	11: 49,651,034		probably null	Het
Fmnl2	G	A	2: 53,128,782	V1078I	probably damaging	Het
Fnip2	A	G	3: 79,480,943	L797P	possibly damaging	Het
Gm10130	A	G	2: 150,362,966	I67V	probably benign	Het
Gm13103	G	A	4: 143,851,655		probably null	Het
Gmeb2	A	T	2: 181,255,957		probably null	Het
Greb1l	A	G	18: 10,537,169	T1045A	probably benign	Het
Hapln1	A	G	13: 89,605,411	N232S	probably benign	Het
Hibadh	A	T	6: 52,546,980	M311K	probably benign	Het
Hus1	C	T	11: 9,010,240		probably null	Het
Il31ra	T	C	13: 112,524,135	E640G	probably benign	Het
L3mbtl4	T	C	17: 68,455,774	F101L	probably damaging	Het
Lbr	A	T	1: 181,819,961	M417K	probably benign	Het
Lrig3	T	G	10: 126,008,740	L691R	probably damaging	Het
Mcm3ap	T	A	10: 76,483,314	F792Y	probably benign	Het
Mst1	T	C	9: 108,084,209		probably null	Het
Nova2	C	A	7: 18,958,446	T500K	probably damaging	Het
Nxph4	A	T	10: 127,526,264	C253S	probably damaging	Het
Olfr1193	T	A	2: 88,678,148	S98T	possibly damaging	Het
Olfr31	T	C	14: 14,328,878	Y256H	probably damaging	Het
Pcdhga3	G	A	18: 37,675,694	R400Q	probably benign	Het
Pidd1	C	A	7: 141,438,594	A915S	probably damaging	Het
Plat	T	G	8: 22,772,722	W148G	probably damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ptdss1	A	G	13: 66,933,599	D31G	possibly damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Samd8	A	G	14: 21,775,168	D64G	probably damaging	Het
Scgb1b20	A	G	7: 33,373,231		probably null	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc25a23	T	C	17: 57,053,336	I269V	probably benign	Het
Slc35f4	A	T	14: 49,318,874	S141T	probably damaging	Het
Srgap1	T	C	10: 121,785,760	M966V	probably benign	Het
Syne2	T	A	12: 76,059,439	V5526E	probably damaging	Het
Tcaf3	A	G	6: 42,591,926	S596P	probably benign	Het
Ttc6	C	T	12: 57,737,031	R1759*	probably null	Het
Wdsub1	T	C	2: 59,870,478	N138D	probably benign	Het

Other mutations in Tg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Tg	APN	15	66847166	missense	probably damaging	1.00
IGL00230:Tg	APN	15	66827290	missense	probably benign	0.00
IGL00324:Tg	APN	15	66693424	missense	probably benign
IGL00428:Tg	APN	15	66773424	missense	probably benign	0.33
IGL00703:Tg	APN	15	66696489	missense	probably benign	0.34
IGL00808:Tg	APN	15	66683813	missense	probably damaging	1.00
IGL00833:Tg	APN	15	66688801	missense	probably benign	0.34
IGL00899:Tg	APN	15	66674073	critical splice donor site	probably null
IGL00921:Tg	APN	15	66764453	missense	probably benign	0.28
IGL00975:Tg	APN	15	66681882	missense	probably benign
IGL01288:Tg	APN	15	66736276	missense	possibly damaging	0.81
IGL01397:Tg	APN	15	66696092	splice site	probably benign
IGL01634:Tg	APN	15	66729566	missense	probably benign	0.34
IGL01646:Tg	APN	15	66678087	missense	probably damaging	1.00
IGL01704:Tg	APN	15	66671351	missense	probably damaging	0.98
IGL01958:Tg	APN	15	66759486	missense	probably benign	0.06
IGL02093:Tg	APN	15	66692374	missense	possibly damaging	0.83
IGL02113:Tg	APN	15	66705330	missense	probably benign	0.08
IGL02138:Tg	APN	15	66717233	missense	probably benign	0.01
IGL02156:Tg	APN	15	66705348	missense	probably benign	0.19
IGL02169:Tg	APN	15	66757943	missense	probably benign	0.04
IGL02342:Tg	APN	15	66764291	missense	probably benign
IGL02434:Tg	APN	15	66764342	missense	probably damaging	0.97
IGL02506:Tg	APN	15	66741594	missense	possibly damaging	0.71
IGL02513:Tg	APN	15	66705274	missense	probably benign
IGL02549:Tg	APN	15	66839361	missense	probably damaging	1.00
IGL02669:Tg	APN	15	66748726	splice site	probably benign
IGL02756:Tg	APN	15	66734586	missense	probably benign
IGL02800:Tg	APN	15	66757886	missense	probably damaging	1.00
IGL02828:Tg	APN	15	66682394	missense	probably damaging	1.00
IGL02927:Tg	APN	15	66678093	missense	probably damaging	1.00
IGL03061:Tg	APN	15	66671405	missense	probably damaging	1.00
IGL03105:Tg	APN	15	66715106	missense	probably benign	0.01
IGL03160:Tg	APN	15	66839303	nonsense	probably null
IGL03242:Tg	APN	15	66683798	missense	probably damaging	0.99
Also_ran	UTSW	15	66678839	missense	probably damaging	1.00
bedraggled	UTSW	15	66740714	missense	probably damaging	1.00
foster	UTSW	15	66693260	nonsense	probably null
hognose	UTSW	15	66717208	missense	probably damaging	0.99
ito	UTSW	15	66766162	nonsense	probably null
ito2	UTSW	15	66671396	missense	probably damaging	1.00
ito3	UTSW	15	66773474	missense	probably damaging	1.00
ito4	UTSW	15	66696520	missense	possibly damaging	0.47
Papua	UTSW	15	66674050	missense	probably damaging	1.00
Pipistrella	UTSW	15	66696135	missense	probably damaging	1.00
pluribus	UTSW	15	66715163	missense	probably damaging	0.98
samarai	UTSW	15	66758006	critical splice donor site	probably null
sariba	UTSW	15	66694870	missense	probably benign	0.01
ticker	UTSW	15	66827382	nonsense	probably null
Vampire	UTSW	15	66682827	missense	probably damaging	1.00
IGL03134:Tg	UTSW	15	66740718	missense	probably damaging	1.00
P0019:Tg	UTSW	15	66688863	missense	probably benign	0.01
R0121:Tg	UTSW	15	66740781	missense	probably benign	0.04
R0135:Tg	UTSW	15	66694870	missense	probably benign	0.01
R0227:Tg	UTSW	15	66698446	missense	possibly damaging	0.84
R0448:Tg	UTSW	15	66764442	missense	probably damaging	1.00
R0453:Tg	UTSW	15	66828533	missense	probably benign	0.09
R0504:Tg	UTSW	15	66682404	missense	probably damaging	0.97
R0543:Tg	UTSW	15	66729597	missense	probably benign	0.13
R0638:Tg	UTSW	15	66717208	missense	probably damaging	0.99
R0639:Tg	UTSW	15	66741484	critical splice acceptor site	probably null
R0646:Tg	UTSW	15	66729626	missense	probably damaging	0.99
R0666:Tg	UTSW	15	66737521	missense	probably benign
R0673:Tg	UTSW	15	66741484	critical splice acceptor site	probably null
R0689:Tg	UTSW	15	66839404	splice site	probably benign
R0704:Tg	UTSW	15	66757880	missense	probably benign	0.02
R0730:Tg	UTSW	15	66678789	missense	probably damaging	1.00
R0830:Tg	UTSW	15	66725144	missense	probably damaging	1.00
R0959:Tg	UTSW	15	66708010	missense	probably damaging	0.98
R1027:Tg	UTSW	15	66672409	missense	possibly damaging	0.65
R1061:Tg	UTSW	15	66698559	missense	probably benign	0.09
R1086:Tg	UTSW	15	66684062	missense	probably benign
R1103:Tg	UTSW	15	66719655	missense	probably benign	0.45
R1240:Tg	UTSW	15	66828548	missense	probably benign	0.16
R1281:Tg	UTSW	15	66696489	missense	probably benign	0.34
R1470:Tg	UTSW	15	66849463	missense	possibly damaging	0.95
R1470:Tg	UTSW	15	66849463	missense	possibly damaging	0.95
R1531:Tg	UTSW	15	66850502	missense	probably benign	0.02
R1544:Tg	UTSW	15	66705232	missense	probably benign	0.04
R1550:Tg	UTSW	15	66693430	missense	possibly damaging	0.52
R1575:Tg	UTSW	15	66729685	critical splice donor site	probably null
R1638:Tg	UTSW	15	66696166	nonsense	probably null
R1655:Tg	UTSW	15	66828568	critical splice donor site	probably null
R1671:Tg	UTSW	15	66692387	missense	possibly damaging	0.89
R1789:Tg	UTSW	15	66737548	missense	probably benign	0.00
R1883:Tg	UTSW	15	66671309	missense	probably damaging	1.00
R1984:Tg	UTSW	15	66682842	missense	probably benign
R2063:Tg	UTSW	15	66828553	missense	probably damaging	1.00
R2092:Tg	UTSW	15	66849607	missense	probably null	0.26
R2109:Tg	UTSW	15	66729594	missense	probably benign	0.02
R2128:Tg	UTSW	15	66694894	missense	probably benign	0.10
R2129:Tg	UTSW	15	66694894	missense	probably benign	0.10
R2207:Tg	UTSW	15	66681939	missense	probably benign	0.15
R2219:Tg	UTSW	15	66681933	missense	probably benign	0.03
R2228:Tg	UTSW	15	66674011	missense	probably damaging	0.99
R2229:Tg	UTSW	15	66674011	missense	probably damaging	0.99
R2259:Tg	UTSW	15	66683898	missense	probably benign
R2994:Tg	UTSW	15	66681953	missense	probably benign
R3904:Tg	UTSW	15	66766162	nonsense	probably null
R3946:Tg	UTSW	15	66674023	missense	probably damaging	1.00
R3965:Tg	UTSW	15	66684190	missense	probably benign
R4245:Tg	UTSW	15	66696469	missense	possibly damaging	0.68
R4451:Tg	UTSW	15	66766147	missense	probably benign	0.01
R4487:Tg	UTSW	15	66671396	missense	probably damaging	1.00
R4489:Tg	UTSW	15	66707942	missense	probably damaging	1.00
R4623:Tg	UTSW	15	66735271	missense	probably benign	0.23
R4659:Tg	UTSW	15	66673920	missense	possibly damaging	0.67
R4728:Tg	UTSW	15	66682827	missense	probably damaging	1.00
R4760:Tg	UTSW	15	66693319	missense	probably damaging	1.00
R4797:Tg	UTSW	15	66758006	critical splice donor site	probably null
R4944:Tg	UTSW	15	66764337	missense	probably damaging	1.00
R4998:Tg	UTSW	15	66674050	missense	probably damaging	1.00
R5009:Tg	UTSW	15	66696586	missense	probably benign	0.01
R5025:Tg	UTSW	15	66707930	missense	probably damaging	1.00
R5035:Tg	UTSW	15	66681813	splice site	probably null
R5049:Tg	UTSW	15	66827382	nonsense	probably null
R5073:Tg	UTSW	15	66735252	missense	probably benign	0.05
R5169:Tg	UTSW	15	66678780	nonsense	probably null
R5185:Tg	UTSW	15	66773474	missense	probably damaging	1.00
R5227:Tg	UTSW	15	66759567	missense	possibly damaging	0.87
R5300:Tg	UTSW	15	66678855	missense	probably damaging	1.00
R5334:Tg	UTSW	15	66678055	missense	probably damaging	1.00
R5339:Tg	UTSW	15	66678093	missense	probably damaging	1.00
R5441:Tg	UTSW	15	66696520	missense	possibly damaging	0.47
R5509:Tg	UTSW	15	66827293	missense	probably benign	0.45
R5580:Tg	UTSW	15	66685300	missense	possibly damaging	0.66
R5582:Tg	UTSW	15	66693435	missense	probably damaging	1.00
R5624:Tg	UTSW	15	66838057	missense	probably benign	0.11
R5686:Tg	UTSW	15	66688889	missense	probably benign	0.28
R6042:Tg	UTSW	15	66683993	missense	probably benign	0.01
R6122:Tg	UTSW	15	66828457	missense	probably damaging	1.00
R6146:Tg	UTSW	15	66673367	splice site	probably null
R6159:Tg	UTSW	15	66735247	missense	possibly damaging	0.71
R6223:Tg	UTSW	15	66707922	missense	probably benign	0.15
R6480:Tg	UTSW	15	66671311	missense	probably damaging	1.00
R6505:Tg	UTSW	15	66759558	missense	probably damaging	0.99
R6531:Tg	UTSW	15	66839362	missense	probably damaging	0.99
R6614:Tg	UTSW	15	66735259	missense	probably damaging	0.99
R6698:Tg	UTSW	15	66839362	missense	probably damaging	1.00
R6798:Tg	UTSW	15	66678839	missense	probably damaging	1.00
R6837:Tg	UTSW	15	66696135	missense	probably damaging	1.00
R6861:Tg	UTSW	15	66688891	missense	probably benign	0.00
R6888:Tg	UTSW	15	66696246	missense	probably damaging	0.99
R6933:Tg	UTSW	15	66764309	missense	possibly damaging	0.73
R6983:Tg	UTSW	15	66693358	missense	probably benign	0.01
R7078:Tg	UTSW	15	66673543	missense	probably damaging	1.00
R7244:Tg	UTSW	15	66740714	missense	probably damaging	1.00
R7320:Tg	UTSW	15	66694784	missense	possibly damaging	0.71
R7334:Tg	UTSW	15	66725272	missense	probably benign	0.01
R7418:Tg	UTSW	15	66696583	missense	probably damaging	0.99
R7485:Tg	UTSW	15	66696588	missense	probably benign	0.04
R7524:Tg	UTSW	15	66696161	missense	probably benign	0.01
R7529:Tg	UTSW	15	66694768	missense	probably damaging	0.99
R7540:Tg	UTSW	15	66689927	missense	probably benign	0.16
R7583:Tg	UTSW	15	66764418	missense	probably damaging	1.00
R7594:Tg	UTSW	15	66729583	missense	probably benign	0.20
R7667:Tg	UTSW	15	66715163	missense	probably damaging	0.98
R7722:Tg	UTSW	15	66764309	missense	possibly damaging	0.73
R7790:Tg	UTSW	15	66849604	missense	probably damaging	0.99
R7838:Tg	UTSW	15	66693263	missense	probably benign	0.00
R7890:Tg	UTSW	15	66683814	missense	probably damaging	1.00
R7904:Tg	UTSW	15	66705279	missense	probably benign	0.08
R7919:Tg	UTSW	15	66684074	missense	possibly damaging	0.73
R7921:Tg	UTSW	15	66683793	missense	probably benign	0.08
R8037:Tg	UTSW	15	66688875	missense	probably benign	0.00
R8038:Tg	UTSW	15	66688875	missense	probably benign	0.00
R8214:Tg	UTSW	15	66773398	missense	probably damaging	1.00
R8304:Tg	UTSW	15	66693260	nonsense	probably null
R8688:Tg	UTSW	15	66694953	critical splice donor site	probably benign
R8709:Tg	UTSW	15	66681937	missense	probably benign	0.08
R8714:Tg	UTSW	15	66684042	missense	probably damaging	0.97
R8901:Tg	UTSW	15	66685335	missense	probably damaging	1.00
R8917:Tg	UTSW	15	66773483	critical splice donor site	probably null
R9023:Tg	UTSW	15	66683673	missense	probably damaging	1.00
R9232:Tg	UTSW	15	66698461	missense	probably benign	0.01
R9310:Tg	UTSW	15	66827269	missense	possibly damaging	0.69
R9361:Tg	UTSW	15	66685397	missense	possibly damaging	0.50
R9389:Tg	UTSW	15	66689324	missense	probably benign	0.04
R9501:Tg	UTSW	15	66847074	missense	possibly damaging	0.52
R9510:Tg	UTSW	15	66674064	missense	probably damaging	1.00
R9594:Tg	UTSW	15	66735260	nonsense	probably null
R9629:Tg	UTSW	15	66683738	missense	possibly damaging	0.95
R9701:Tg	UTSW	15	66766142	missense	probably benign	0.03
R9743:Tg	UTSW	15	66689990	missense	probably benign	0.18
R9748:Tg	UTSW	15	66847159	missense	possibly damaging	0.91
T0975:Tg	UTSW	15	66688863	missense	probably benign	0.01
X0005:Tg	UTSW	15	66688863	missense	probably benign	0.01
X0065:Tg	UTSW	15	66682454	missense	probably damaging	1.00
X0067:Tg	UTSW	15	66748743	missense	probably benign	0.10
Z1177:Tg	UTSW	15	66685310	missense	possibly damaging	0.49
Z1177:Tg	UTSW	15	66849547	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTTCGTCTAGTAAGATTTGGAGAGC -3'
(R):5'- AGTATTTAATGTCCTGTGCCTTCAC -3'

Sequencing Primer
(F):5'- GAGCAAATGTGTGAGTTTAATTTGCC -3'
(R):5'- ACCAAGGCTTTCTGATCTGG -3'

Posted On

2016-09-06