Incidental Mutation 'R5402:Tg'
ID 430073
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Name thyroglobulin
Synonyms Tgn
MMRRC Submission 042973-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R5402 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 66542606-66722570 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 66611017 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 356 (I356N)
Ref Sequence ENSEMBL: ENSMUSP00000126454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000163495] [ENSMUST00000171045]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000065916
AA Change: I1975N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: I1975N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163495
SMART Domains Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
TY 14 63 1.21e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169163
Predicted Effect probably damaging
Transcript: ENSMUST00000171045
AA Change: I356N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469
AA Change: I356N

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172153
SMART Domains Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
Pfam:COesterase 313 849 6e-140 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,607,834 (GRCm39) D4079E probably benign Het
Bcar1 T C 8: 112,440,962 (GRCm39) D344G probably damaging Het
Car9 A G 4: 43,510,213 (GRCm39) N265S probably damaging Het
Ccr7 A G 11: 99,036,560 (GRCm39) S121P possibly damaging Het
Cgnl1 A G 9: 71,536,603 (GRCm39) L1278P probably damaging Het
Chst9 A T 18: 15,585,872 (GRCm39) S230R probably damaging Het
Cped1 G A 6: 22,143,951 (GRCm39) V566M probably benign Het
Csf2 A T 11: 54,138,489 (GRCm39) Y117* probably null Het
Cwf19l1 C T 19: 44,121,524 (GRCm39) probably null Het
Cyp2d34 C T 15: 82,503,287 (GRCm39) G69D probably damaging Het
Dync2h1 A T 9: 7,114,949 (GRCm39) V170E probably damaging Het
Ehbp1l1 T A 19: 5,766,348 (GRCm39) T388S possibly damaging Het
Etfa T C 9: 55,362,023 (GRCm39) I329M probably benign Het
Flt4 AC ACC 11: 49,541,861 (GRCm39) probably null Het
Fmnl2 G A 2: 53,018,794 (GRCm39) V1078I probably damaging Het
Fnip2 A G 3: 79,388,250 (GRCm39) L797P possibly damaging Het
Gmeb2 A T 2: 180,897,750 (GRCm39) probably null Het
Greb1l A G 18: 10,537,169 (GRCm39) T1045A probably benign Het
Hapln1 A G 13: 89,753,530 (GRCm39) N232S probably benign Het
Hibadh A T 6: 52,523,965 (GRCm39) M311K probably benign Het
Hus1 C T 11: 8,960,240 (GRCm39) probably null Het
Il31ra T C 13: 112,660,669 (GRCm39) E640G probably benign Het
L3mbtl4 T C 17: 68,762,769 (GRCm39) F101L probably damaging Het
Lbr A T 1: 181,647,526 (GRCm39) M417K probably benign Het
Lrig3 T G 10: 125,844,609 (GRCm39) L691R probably damaging Het
Mcm3ap T A 10: 76,319,148 (GRCm39) F792Y probably benign Het
Mst1 T C 9: 107,961,408 (GRCm39) probably null Het
Nova2 C A 7: 18,692,371 (GRCm39) T500K probably damaging Het
Nxph4 A T 10: 127,362,133 (GRCm39) C253S probably damaging Het
Or2t1 T C 14: 14,328,878 (GRCm38) Y256H probably damaging Het
Or4s2b T A 2: 88,508,492 (GRCm39) S98T possibly damaging Het
Pcdhga3 G A 18: 37,808,747 (GRCm39) R400Q probably benign Het
Pidd1 C A 7: 141,018,507 (GRCm39) A915S probably damaging Het
Plat T G 8: 23,262,738 (GRCm39) W148G probably damaging Het
Polr3a T C 14: 24,505,009 (GRCm39) I1084V possibly damaging Het
Pramel27 G A 4: 143,578,225 (GRCm39) probably null Het
Ptdss1 A G 13: 67,081,663 (GRCm39) D31G possibly damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Samd8 A G 14: 21,825,236 (GRCm39) D64G probably damaging Het
Scgb1b20 A G 7: 33,072,656 (GRCm39) probably null Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc25a23 T C 17: 57,360,336 (GRCm39) I269V probably benign Het
Slc35f4 A T 14: 49,556,331 (GRCm39) S141T probably damaging Het
Srgap1 T C 10: 121,621,665 (GRCm39) M966V probably benign Het
Syne2 T A 12: 76,106,213 (GRCm39) V5526E probably damaging Het
Tcaf3 A G 6: 42,568,860 (GRCm39) S596P probably benign Het
Ttc6 C T 12: 57,783,817 (GRCm39) R1759* probably null Het
Wdsub1 T C 2: 59,700,822 (GRCm39) N138D probably benign Het
Zfp1001 A G 2: 150,204,886 (GRCm39) I67V probably benign Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66,719,015 (GRCm39) missense probably damaging 1.00
IGL00230:Tg APN 15 66,699,139 (GRCm39) missense probably benign 0.00
IGL00324:Tg APN 15 66,565,273 (GRCm39) missense probably benign
IGL00428:Tg APN 15 66,645,273 (GRCm39) missense probably benign 0.33
IGL00703:Tg APN 15 66,568,338 (GRCm39) missense probably benign 0.34
IGL00808:Tg APN 15 66,555,662 (GRCm39) missense probably damaging 1.00
IGL00833:Tg APN 15 66,560,650 (GRCm39) missense probably benign 0.34
IGL00899:Tg APN 15 66,545,922 (GRCm39) critical splice donor site probably null
IGL00921:Tg APN 15 66,636,302 (GRCm39) missense probably benign 0.28
IGL00975:Tg APN 15 66,553,731 (GRCm39) missense probably benign
IGL01288:Tg APN 15 66,608,125 (GRCm39) missense possibly damaging 0.81
IGL01397:Tg APN 15 66,567,941 (GRCm39) splice site probably benign
IGL01634:Tg APN 15 66,601,415 (GRCm39) missense probably benign 0.34
IGL01646:Tg APN 15 66,549,936 (GRCm39) missense probably damaging 1.00
IGL01704:Tg APN 15 66,543,200 (GRCm39) missense probably damaging 0.98
IGL01958:Tg APN 15 66,631,335 (GRCm39) missense probably benign 0.06
IGL02093:Tg APN 15 66,564,223 (GRCm39) missense possibly damaging 0.83
IGL02113:Tg APN 15 66,577,179 (GRCm39) missense probably benign 0.08
IGL02138:Tg APN 15 66,589,082 (GRCm39) missense probably benign 0.01
IGL02156:Tg APN 15 66,577,197 (GRCm39) missense probably benign 0.19
IGL02169:Tg APN 15 66,629,792 (GRCm39) missense probably benign 0.04
IGL02342:Tg APN 15 66,636,140 (GRCm39) missense probably benign
IGL02434:Tg APN 15 66,636,191 (GRCm39) missense probably damaging 0.97
IGL02506:Tg APN 15 66,613,443 (GRCm39) missense possibly damaging 0.71
IGL02513:Tg APN 15 66,577,123 (GRCm39) missense probably benign
IGL02549:Tg APN 15 66,711,210 (GRCm39) missense probably damaging 1.00
IGL02669:Tg APN 15 66,620,575 (GRCm39) splice site probably benign
IGL02756:Tg APN 15 66,606,435 (GRCm39) missense probably benign
IGL02800:Tg APN 15 66,629,735 (GRCm39) missense probably damaging 1.00
IGL02828:Tg APN 15 66,554,243 (GRCm39) missense probably damaging 1.00
IGL02927:Tg APN 15 66,549,942 (GRCm39) missense probably damaging 1.00
IGL03061:Tg APN 15 66,543,254 (GRCm39) missense probably damaging 1.00
IGL03105:Tg APN 15 66,586,955 (GRCm39) missense probably benign 0.01
IGL03160:Tg APN 15 66,711,152 (GRCm39) nonsense probably null
IGL03242:Tg APN 15 66,555,647 (GRCm39) missense probably damaging 0.99
Also_ran UTSW 15 66,550,688 (GRCm39) missense probably damaging 1.00
bedraggled UTSW 15 66,612,563 (GRCm39) missense probably damaging 1.00
foster UTSW 15 66,565,109 (GRCm39) nonsense probably null
hognose UTSW 15 66,589,057 (GRCm39) missense probably damaging 0.99
ito UTSW 15 66,638,011 (GRCm39) nonsense probably null
ito2 UTSW 15 66,543,245 (GRCm39) missense probably damaging 1.00
ito3 UTSW 15 66,645,323 (GRCm39) missense probably damaging 1.00
ito4 UTSW 15 66,568,369 (GRCm39) missense possibly damaging 0.47
Papua UTSW 15 66,545,899 (GRCm39) missense probably damaging 1.00
Pipistrella UTSW 15 66,567,984 (GRCm39) missense probably damaging 1.00
pluribus UTSW 15 66,587,012 (GRCm39) missense probably damaging 0.98
samarai UTSW 15 66,629,855 (GRCm39) critical splice donor site probably null
sariba UTSW 15 66,566,719 (GRCm39) missense probably benign 0.01
ticker UTSW 15 66,699,231 (GRCm39) nonsense probably null
Vampire UTSW 15 66,554,676 (GRCm39) missense probably damaging 1.00
IGL03134:Tg UTSW 15 66,612,567 (GRCm39) missense probably damaging 1.00
P0019:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
R0121:Tg UTSW 15 66,612,630 (GRCm39) missense probably benign 0.04
R0135:Tg UTSW 15 66,566,719 (GRCm39) missense probably benign 0.01
R0227:Tg UTSW 15 66,570,295 (GRCm39) missense possibly damaging 0.84
R0448:Tg UTSW 15 66,636,291 (GRCm39) missense probably damaging 1.00
R0453:Tg UTSW 15 66,700,382 (GRCm39) missense probably benign 0.09
R0504:Tg UTSW 15 66,554,253 (GRCm39) missense probably damaging 0.97
R0543:Tg UTSW 15 66,601,446 (GRCm39) missense probably benign 0.13
R0638:Tg UTSW 15 66,589,057 (GRCm39) missense probably damaging 0.99
R0639:Tg UTSW 15 66,613,333 (GRCm39) critical splice acceptor site probably null
R0646:Tg UTSW 15 66,601,475 (GRCm39) missense probably damaging 0.99
R0666:Tg UTSW 15 66,609,370 (GRCm39) missense probably benign
R0673:Tg UTSW 15 66,613,333 (GRCm39) critical splice acceptor site probably null
R0689:Tg UTSW 15 66,711,253 (GRCm39) splice site probably benign
R0704:Tg UTSW 15 66,629,729 (GRCm39) missense probably benign 0.02
R0730:Tg UTSW 15 66,550,638 (GRCm39) missense probably damaging 1.00
R0830:Tg UTSW 15 66,596,993 (GRCm39) missense probably damaging 1.00
R0959:Tg UTSW 15 66,579,859 (GRCm39) missense probably damaging 0.98
R1027:Tg UTSW 15 66,544,258 (GRCm39) missense possibly damaging 0.65
R1061:Tg UTSW 15 66,570,408 (GRCm39) missense probably benign 0.09
R1086:Tg UTSW 15 66,555,911 (GRCm39) missense probably benign
R1103:Tg UTSW 15 66,591,504 (GRCm39) missense probably benign 0.45
R1240:Tg UTSW 15 66,700,397 (GRCm39) missense probably benign 0.16
R1281:Tg UTSW 15 66,568,338 (GRCm39) missense probably benign 0.34
R1470:Tg UTSW 15 66,721,312 (GRCm39) missense possibly damaging 0.95
R1470:Tg UTSW 15 66,721,312 (GRCm39) missense possibly damaging 0.95
R1531:Tg UTSW 15 66,722,351 (GRCm39) missense probably benign 0.02
R1544:Tg UTSW 15 66,577,081 (GRCm39) missense probably benign 0.04
R1550:Tg UTSW 15 66,565,279 (GRCm39) missense possibly damaging 0.52
R1575:Tg UTSW 15 66,601,534 (GRCm39) critical splice donor site probably null
R1638:Tg UTSW 15 66,568,015 (GRCm39) nonsense probably null
R1655:Tg UTSW 15 66,700,417 (GRCm39) critical splice donor site probably null
R1671:Tg UTSW 15 66,564,236 (GRCm39) missense possibly damaging 0.89
R1789:Tg UTSW 15 66,609,397 (GRCm39) missense probably benign 0.00
R1883:Tg UTSW 15 66,543,158 (GRCm39) missense probably damaging 1.00
R1984:Tg UTSW 15 66,554,691 (GRCm39) missense probably benign
R2063:Tg UTSW 15 66,700,402 (GRCm39) missense probably damaging 1.00
R2092:Tg UTSW 15 66,721,456 (GRCm39) missense probably null 0.26
R2109:Tg UTSW 15 66,601,443 (GRCm39) missense probably benign 0.02
R2128:Tg UTSW 15 66,566,743 (GRCm39) missense probably benign 0.10
R2129:Tg UTSW 15 66,566,743 (GRCm39) missense probably benign 0.10
R2207:Tg UTSW 15 66,553,788 (GRCm39) missense probably benign 0.15
R2219:Tg UTSW 15 66,553,782 (GRCm39) missense probably benign 0.03
R2228:Tg UTSW 15 66,545,860 (GRCm39) missense probably damaging 0.99
R2229:Tg UTSW 15 66,545,860 (GRCm39) missense probably damaging 0.99
R2259:Tg UTSW 15 66,555,747 (GRCm39) missense probably benign
R2994:Tg UTSW 15 66,553,802 (GRCm39) missense probably benign
R3904:Tg UTSW 15 66,638,011 (GRCm39) nonsense probably null
R3946:Tg UTSW 15 66,545,872 (GRCm39) missense probably damaging 1.00
R3965:Tg UTSW 15 66,556,039 (GRCm39) missense probably benign
R4245:Tg UTSW 15 66,568,318 (GRCm39) missense possibly damaging 0.68
R4451:Tg UTSW 15 66,637,996 (GRCm39) missense probably benign 0.01
R4487:Tg UTSW 15 66,543,245 (GRCm39) missense probably damaging 1.00
R4489:Tg UTSW 15 66,579,791 (GRCm39) missense probably damaging 1.00
R4623:Tg UTSW 15 66,607,120 (GRCm39) missense probably benign 0.23
R4659:Tg UTSW 15 66,545,769 (GRCm39) missense possibly damaging 0.67
R4728:Tg UTSW 15 66,554,676 (GRCm39) missense probably damaging 1.00
R4760:Tg UTSW 15 66,565,168 (GRCm39) missense probably damaging 1.00
R4797:Tg UTSW 15 66,629,855 (GRCm39) critical splice donor site probably null
R4944:Tg UTSW 15 66,636,186 (GRCm39) missense probably damaging 1.00
R4998:Tg UTSW 15 66,545,899 (GRCm39) missense probably damaging 1.00
R5009:Tg UTSW 15 66,568,435 (GRCm39) missense probably benign 0.01
R5025:Tg UTSW 15 66,579,779 (GRCm39) missense probably damaging 1.00
R5035:Tg UTSW 15 66,553,662 (GRCm39) splice site probably null
R5049:Tg UTSW 15 66,699,231 (GRCm39) nonsense probably null
R5073:Tg UTSW 15 66,607,101 (GRCm39) missense probably benign 0.05
R5169:Tg UTSW 15 66,550,629 (GRCm39) nonsense probably null
R5185:Tg UTSW 15 66,645,323 (GRCm39) missense probably damaging 1.00
R5227:Tg UTSW 15 66,631,416 (GRCm39) missense possibly damaging 0.87
R5300:Tg UTSW 15 66,550,704 (GRCm39) missense probably damaging 1.00
R5334:Tg UTSW 15 66,549,904 (GRCm39) missense probably damaging 1.00
R5339:Tg UTSW 15 66,549,942 (GRCm39) missense probably damaging 1.00
R5441:Tg UTSW 15 66,568,369 (GRCm39) missense possibly damaging 0.47
R5509:Tg UTSW 15 66,699,142 (GRCm39) missense probably benign 0.45
R5580:Tg UTSW 15 66,557,149 (GRCm39) missense possibly damaging 0.66
R5582:Tg UTSW 15 66,565,284 (GRCm39) missense probably damaging 1.00
R5624:Tg UTSW 15 66,709,906 (GRCm39) missense probably benign 0.11
R5686:Tg UTSW 15 66,560,738 (GRCm39) missense probably benign 0.28
R6042:Tg UTSW 15 66,555,842 (GRCm39) missense probably benign 0.01
R6122:Tg UTSW 15 66,700,306 (GRCm39) missense probably damaging 1.00
R6146:Tg UTSW 15 66,545,216 (GRCm39) splice site probably null
R6159:Tg UTSW 15 66,607,096 (GRCm39) missense possibly damaging 0.71
R6223:Tg UTSW 15 66,579,771 (GRCm39) missense probably benign 0.15
R6480:Tg UTSW 15 66,543,160 (GRCm39) missense probably damaging 1.00
R6505:Tg UTSW 15 66,631,407 (GRCm39) missense probably damaging 0.99
R6531:Tg UTSW 15 66,711,211 (GRCm39) missense probably damaging 0.99
R6614:Tg UTSW 15 66,607,108 (GRCm39) missense probably damaging 0.99
R6698:Tg UTSW 15 66,711,211 (GRCm39) missense probably damaging 1.00
R6798:Tg UTSW 15 66,550,688 (GRCm39) missense probably damaging 1.00
R6837:Tg UTSW 15 66,567,984 (GRCm39) missense probably damaging 1.00
R6861:Tg UTSW 15 66,560,740 (GRCm39) missense probably benign 0.00
R6888:Tg UTSW 15 66,568,095 (GRCm39) missense probably damaging 0.99
R6933:Tg UTSW 15 66,636,158 (GRCm39) missense possibly damaging 0.73
R6983:Tg UTSW 15 66,565,207 (GRCm39) missense probably benign 0.01
R7078:Tg UTSW 15 66,545,392 (GRCm39) missense probably damaging 1.00
R7244:Tg UTSW 15 66,612,563 (GRCm39) missense probably damaging 1.00
R7320:Tg UTSW 15 66,566,633 (GRCm39) missense possibly damaging 0.71
R7334:Tg UTSW 15 66,597,121 (GRCm39) missense probably benign 0.01
R7418:Tg UTSW 15 66,568,432 (GRCm39) missense probably damaging 0.99
R7485:Tg UTSW 15 66,568,437 (GRCm39) missense probably benign 0.04
R7524:Tg UTSW 15 66,568,010 (GRCm39) missense probably benign 0.01
R7529:Tg UTSW 15 66,566,617 (GRCm39) missense probably damaging 0.99
R7540:Tg UTSW 15 66,561,776 (GRCm39) missense probably benign 0.16
R7583:Tg UTSW 15 66,636,267 (GRCm39) missense probably damaging 1.00
R7594:Tg UTSW 15 66,601,432 (GRCm39) missense probably benign 0.20
R7667:Tg UTSW 15 66,587,012 (GRCm39) missense probably damaging 0.98
R7722:Tg UTSW 15 66,636,158 (GRCm39) missense possibly damaging 0.73
R7790:Tg UTSW 15 66,721,453 (GRCm39) missense probably damaging 0.99
R7838:Tg UTSW 15 66,565,112 (GRCm39) missense probably benign 0.00
R7890:Tg UTSW 15 66,555,663 (GRCm39) missense probably damaging 1.00
R7904:Tg UTSW 15 66,577,128 (GRCm39) missense probably benign 0.08
R7919:Tg UTSW 15 66,555,923 (GRCm39) missense possibly damaging 0.73
R7921:Tg UTSW 15 66,555,642 (GRCm39) missense probably benign 0.08
R8037:Tg UTSW 15 66,560,724 (GRCm39) missense probably benign 0.00
R8038:Tg UTSW 15 66,560,724 (GRCm39) missense probably benign 0.00
R8214:Tg UTSW 15 66,645,247 (GRCm39) missense probably damaging 1.00
R8304:Tg UTSW 15 66,565,109 (GRCm39) nonsense probably null
R8688:Tg UTSW 15 66,566,802 (GRCm39) critical splice donor site probably benign
R8709:Tg UTSW 15 66,553,786 (GRCm39) missense probably benign 0.08
R8714:Tg UTSW 15 66,555,891 (GRCm39) missense probably damaging 0.97
R8901:Tg UTSW 15 66,557,184 (GRCm39) missense probably damaging 1.00
R8917:Tg UTSW 15 66,645,332 (GRCm39) critical splice donor site probably null
R9023:Tg UTSW 15 66,555,522 (GRCm39) missense probably damaging 1.00
R9232:Tg UTSW 15 66,570,310 (GRCm39) missense probably benign 0.01
R9310:Tg UTSW 15 66,699,118 (GRCm39) missense possibly damaging 0.69
R9361:Tg UTSW 15 66,557,246 (GRCm39) missense possibly damaging 0.50
R9389:Tg UTSW 15 66,561,173 (GRCm39) missense probably benign 0.04
R9501:Tg UTSW 15 66,718,923 (GRCm39) missense possibly damaging 0.52
R9510:Tg UTSW 15 66,545,913 (GRCm39) missense probably damaging 1.00
R9594:Tg UTSW 15 66,607,109 (GRCm39) nonsense probably null
R9629:Tg UTSW 15 66,555,587 (GRCm39) missense possibly damaging 0.95
R9701:Tg UTSW 15 66,637,991 (GRCm39) missense probably benign 0.03
R9743:Tg UTSW 15 66,561,839 (GRCm39) missense probably benign 0.18
R9748:Tg UTSW 15 66,719,008 (GRCm39) missense possibly damaging 0.91
T0975:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
X0005:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
X0065:Tg UTSW 15 66,554,303 (GRCm39) missense probably damaging 1.00
X0067:Tg UTSW 15 66,620,592 (GRCm39) missense probably benign 0.10
Z1177:Tg UTSW 15 66,721,396 (GRCm39) missense probably benign 0.02
Z1177:Tg UTSW 15 66,557,159 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TTTCGTCTAGTAAGATTTGGAGAGC -3'
(R):5'- AGTATTTAATGTCCTGTGCCTTCAC -3'

Sequencing Primer
(F):5'- GAGCAAATGTGTGAGTTTAATTTGCC -3'
(R):5'- ACCAAGGCTTTCTGATCTGG -3'
Posted On 2016-09-06