Incidental Mutation 'R5402:L3mbtl4'
ID430077
Institutional Source Beutler Lab
Gene Symbol L3mbtl4
Ensembl Gene ENSMUSG00000041565
Gene NameL3MBTL4 histone methyl-lysine binding protein
Synonyms
MMRRC Submission 042973-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5402 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location68273797-68777961 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68455774 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 101 (F101L)
Ref Sequence ENSEMBL: ENSMUSP00000121045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093007] [ENSMUST00000124543] [ENSMUST00000139383]
Predicted Effect probably damaging
Transcript: ENSMUST00000093007
AA Change: F101L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000094892
Gene: ENSMUSG00000041565
AA Change: F101L

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
MBT 269 364 2.8e-47 SMART
Pfam:zf-C2HC 378 407 8.1e-16 PFAM
SAM 540 607 5.17e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124543
AA Change: F101L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121045
Gene: ENSMUSG00000041565
AA Change: F101L

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
MBT 269 364 2.8e-47 SMART
Pfam:zf-C2HC 376 407 3.3e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139383
AA Change: F101L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117626
Gene: ENSMUSG00000041565
AA Change: F101L

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150573
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,459,715 D4079E probably benign Het
Bcar1 T C 8: 111,714,330 D344G probably damaging Het
Car9 A G 4: 43,510,213 N265S probably damaging Het
Ccr7 A G 11: 99,145,734 S121P possibly damaging Het
Cgnl1 A G 9: 71,629,321 L1278P probably damaging Het
Chst9 A T 18: 15,452,815 S230R probably damaging Het
Cped1 G A 6: 22,143,952 V566M probably benign Het
Csf2 A T 11: 54,247,663 Y117* probably null Het
Cwf19l1 C T 19: 44,133,085 probably null Het
Cyp2d34 C T 15: 82,619,086 G69D probably damaging Het
Dync2h1 A T 9: 7,114,949 V170E probably damaging Het
Ehbp1l1 T A 19: 5,716,320 T388S possibly damaging Het
Etfa T C 9: 55,454,739 I329M probably benign Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fmnl2 G A 2: 53,128,782 V1078I probably damaging Het
Fnip2 A G 3: 79,480,943 L797P possibly damaging Het
Gm10130 A G 2: 150,362,966 I67V probably benign Het
Gm13103 G A 4: 143,851,655 probably null Het
Gmeb2 A T 2: 181,255,957 probably null Het
Greb1l A G 18: 10,537,169 T1045A probably benign Het
Hapln1 A G 13: 89,605,411 N232S probably benign Het
Hibadh A T 6: 52,546,980 M311K probably benign Het
Hus1 C T 11: 9,010,240 probably null Het
Il31ra T C 13: 112,524,135 E640G probably benign Het
Lbr A T 1: 181,819,961 M417K probably benign Het
Lrig3 T G 10: 126,008,740 L691R probably damaging Het
Mcm3ap T A 10: 76,483,314 F792Y probably benign Het
Mst1 T C 9: 108,084,209 probably null Het
Nova2 C A 7: 18,958,446 T500K probably damaging Het
Nxph4 A T 10: 127,526,264 C253S probably damaging Het
Olfr1193 T A 2: 88,678,148 S98T possibly damaging Het
Olfr31 T C 14: 14,328,878 Y256H probably damaging Het
Pcdhga3 G A 18: 37,675,694 R400Q probably benign Het
Pidd1 C A 7: 141,438,594 A915S probably damaging Het
Plat T G 8: 22,772,722 W148G probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ptdss1 A G 13: 66,933,599 D31G possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Samd8 A G 14: 21,775,168 D64G probably damaging Het
Scgb1b20 A G 7: 33,373,231 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc25a23 T C 17: 57,053,336 I269V probably benign Het
Slc35f4 A T 14: 49,318,874 S141T probably damaging Het
Srgap1 T C 10: 121,785,760 M966V probably benign Het
Syne2 T A 12: 76,059,439 V5526E probably damaging Het
Tcaf3 A G 6: 42,591,926 S596P probably benign Het
Tg T A 15: 66,739,168 I356N probably damaging Het
Ttc6 C T 12: 57,737,031 R1759* probably null Het
Wdsub1 T C 2: 59,870,478 N138D probably benign Het
Other mutations in L3mbtl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:L3mbtl4 APN 17 68630202 missense probably damaging 1.00
IGL02274:L3mbtl4 APN 17 68764584 missense probably benign 0.01
IGL02304:L3mbtl4 APN 17 68587185 nonsense probably null
IGL02473:L3mbtl4 APN 17 68559777 missense possibly damaging 0.93
IGL02543:L3mbtl4 APN 17 68461612 splice site probably benign
IGL02706:L3mbtl4 APN 17 68486919 missense probably damaging 1.00
IGL02729:L3mbtl4 APN 17 68484743 missense probably benign 0.23
IGL02817:L3mbtl4 APN 17 68630254 missense probably benign 0.30
IGL03237:L3mbtl4 APN 17 68777861 missense probably damaging 1.00
IGL03371:L3mbtl4 APN 17 68461568 missense probably damaging 1.00
R0092:L3mbtl4 UTSW 17 68425703 missense probably benign 0.01
R0389:L3mbtl4 UTSW 17 68455780 missense probably damaging 1.00
R0504:L3mbtl4 UTSW 17 68777912 missense probably benign 0.07
R0598:L3mbtl4 UTSW 17 68459773 missense probably benign 0.04
R0650:L3mbtl4 UTSW 17 68774291 missense probably damaging 1.00
R0652:L3mbtl4 UTSW 17 68774291 missense probably damaging 1.00
R0842:L3mbtl4 UTSW 17 68486962 missense probably benign 0.19
R1900:L3mbtl4 UTSW 17 68459805 missense probably damaging 0.99
R2065:L3mbtl4 UTSW 17 68425692 missense probably benign 0.04
R2173:L3mbtl4 UTSW 17 68587193 missense probably damaging 1.00
R2987:L3mbtl4 UTSW 17 68359518 missense possibly damaging 0.89
R3119:L3mbtl4 UTSW 17 68425674 missense probably benign 0.02
R3153:L3mbtl4 UTSW 17 68457248 nonsense probably null
R4044:L3mbtl4 UTSW 17 68777914 missense possibly damaging 0.63
R4579:L3mbtl4 UTSW 17 68764640 missense probably benign
R4717:L3mbtl4 UTSW 17 68455713 missense probably null 0.67
R4798:L3mbtl4 UTSW 17 68359480 start codon destroyed probably null 0.03
R4831:L3mbtl4 UTSW 17 68461563 missense probably damaging 0.98
R4852:L3mbtl4 UTSW 17 68559753 missense probably damaging 1.00
R5226:L3mbtl4 UTSW 17 68764722 critical splice donor site probably null
R5604:L3mbtl4 UTSW 17 68777922 missense probably benign 0.01
R6377:L3mbtl4 UTSW 17 68777923 missense probably benign 0.04
R6708:L3mbtl4 UTSW 17 68630258 missense probably benign 0.19
R6853:L3mbtl4 UTSW 17 68777920 missense probably damaging 0.97
R6905:L3mbtl4 UTSW 17 68777888 missense probably benign 0.05
R7018:L3mbtl4 UTSW 17 68486943 missense probably damaging 1.00
R7045:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7047:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7049:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7419:L3mbtl4 UTSW 17 68641542 missense probably benign 0.28
X0063:L3mbtl4 UTSW 17 68630253 missense probably benign 0.37
Z1176:L3mbtl4 UTSW 17 68425687 missense not run
Predicted Primers PCR Primer
(F):5'- AAATTTCTGTTACCTGACTTTTGGC -3'
(R):5'- TGAATACGAGTTGACGAAAACTTAC -3'

Sequencing Primer
(F):5'- CTACAGCCTTGAATCTTTGAGTAG -3'
(R):5'- GCTGGGACTCACTTATGA -3'
Posted On2016-09-06