Incidental Mutation 'R5402:Greb1l'
ID430078
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission 042973-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5402 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10537169 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1045 (T1045A)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: T1045A

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: T1045A

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
AA Change: T936A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: T936A

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,459,715 D4079E probably benign Het
Bcar1 T C 8: 111,714,330 D344G probably damaging Het
Car9 A G 4: 43,510,213 N265S probably damaging Het
Ccr7 A G 11: 99,145,734 S121P possibly damaging Het
Cgnl1 A G 9: 71,629,321 L1278P probably damaging Het
Chst9 A T 18: 15,452,815 S230R probably damaging Het
Cped1 G A 6: 22,143,952 V566M probably benign Het
Csf2 A T 11: 54,247,663 Y117* probably null Het
Cwf19l1 C T 19: 44,133,085 probably null Het
Cyp2d34 C T 15: 82,619,086 G69D probably damaging Het
Dync2h1 A T 9: 7,114,949 V170E probably damaging Het
Ehbp1l1 T A 19: 5,716,320 T388S possibly damaging Het
Etfa T C 9: 55,454,739 I329M probably benign Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fmnl2 G A 2: 53,128,782 V1078I probably damaging Het
Fnip2 A G 3: 79,480,943 L797P possibly damaging Het
Gm10130 A G 2: 150,362,966 I67V probably benign Het
Gm13103 G A 4: 143,851,655 probably null Het
Gmeb2 A T 2: 181,255,957 probably null Het
Hapln1 A G 13: 89,605,411 N232S probably benign Het
Hibadh A T 6: 52,546,980 M311K probably benign Het
Hus1 C T 11: 9,010,240 probably null Het
Il31ra T C 13: 112,524,135 E640G probably benign Het
L3mbtl4 T C 17: 68,455,774 F101L probably damaging Het
Lbr A T 1: 181,819,961 M417K probably benign Het
Lrig3 T G 10: 126,008,740 L691R probably damaging Het
Mcm3ap T A 10: 76,483,314 F792Y probably benign Het
Mst1 T C 9: 108,084,209 probably null Het
Nova2 C A 7: 18,958,446 T500K probably damaging Het
Nxph4 A T 10: 127,526,264 C253S probably damaging Het
Olfr1193 T A 2: 88,678,148 S98T possibly damaging Het
Olfr31 T C 14: 14,328,878 Y256H probably damaging Het
Pcdhga3 G A 18: 37,675,694 R400Q probably benign Het
Pidd1 C A 7: 141,438,594 A915S probably damaging Het
Plat T G 8: 22,772,722 W148G probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ptdss1 A G 13: 66,933,599 D31G possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Samd8 A G 14: 21,775,168 D64G probably damaging Het
Scgb1b20 A G 7: 33,373,231 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc25a23 T C 17: 57,053,336 I269V probably benign Het
Slc35f4 A T 14: 49,318,874 S141T probably damaging Het
Srgap1 T C 10: 121,785,760 M966V probably benign Het
Syne2 T A 12: 76,059,439 V5526E probably damaging Het
Tcaf3 A G 6: 42,591,926 S596P probably benign Het
Tg T A 15: 66,739,168 I356N probably damaging Het
Ttc6 C T 12: 57,737,031 R1759* probably null Het
Wdsub1 T C 2: 59,870,478 N138D probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7915:Greb1l UTSW 18 10542056 missense probably benign 0.38
Z1176:Greb1l UTSW 18 10515305 missense not run
Predicted Primers PCR Primer
(F):5'- GTCTGAAGCCTGTATCCACAAAC -3'
(R):5'- TGGGGTATAACCACTTTTCCTCTG -3'

Sequencing Primer
(F):5'- GTATCTCTTCTGTAGACCTGG -3'
(R):5'- TGGCCCCATTCCCGAACTG -3'
Posted On2016-09-06