Incidental Mutation 'R5403:Dlg2'
ID430102
Institutional Source Beutler Lab
Gene Symbol Dlg2
Ensembl Gene ENSMUSG00000052572
Gene Namediscs large MAGUK scaffold protein 2
SynonymsDlgh2, A330103J02Rik, Chapsyn-110, PSD93, B330007M19Rik, LOC382816, B230218P12Rik
MMRRC Submission 042974-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5403 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location90476672-92449247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92431002 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 598 (T598A)
Ref Sequence ENSEMBL: ENSMUSP00000102811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074273] [ENSMUST00000098308] [ENSMUST00000107193] [ENSMUST00000107196] [ENSMUST00000231777]
Predicted Effect probably damaging
Transcript: ENSMUST00000074273
AA Change: T713A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073885
Gene: ENSMUSG00000052572
AA Change: T713A

DomainStartEndE-ValueType
MAGUK_N_PEST 14 97 1.5e-47 SMART
PDZ 106 185 1.15e-23 SMART
PDZ 201 280 9.86e-23 SMART
PDZ 429 502 1.77e-24 SMART
low complexity region 523 530 N/A INTRINSIC
SH3 539 605 7.82e-10 SMART
low complexity region 631 644 N/A INTRINSIC
GuKc 679 858 2.6e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098308
AA Change: T324A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095910
Gene: ENSMUSG00000052572
AA Change: T324A

DomainStartEndE-ValueType
PDZ 26 99 1.77e-24 SMART
low complexity region 120 127 N/A INTRINSIC
SH3 136 202 7.82e-10 SMART
low complexity region 228 241 N/A INTRINSIC
GuKc 290 469 2.6e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107193
AA Change: T598A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102811
Gene: ENSMUSG00000052572
AA Change: T598A

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
PDZ 61 140 1.15e-23 SMART
PDZ 156 235 9.86e-23 SMART
PDZ 332 405 1.77e-24 SMART
low complexity region 426 433 N/A INTRINSIC
SH3 442 508 7.82e-10 SMART
GuKc 564 743 2.6e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107196
AA Change: T695A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102814
Gene: ENSMUSG00000052572
AA Change: T695A

DomainStartEndE-ValueType
MAGUK_N_PEST 14 97 1.5e-47 SMART
PDZ 106 185 1.15e-23 SMART
PDZ 201 280 9.86e-23 SMART
PDZ 429 502 1.77e-24 SMART
low complexity region 523 530 N/A INTRINSIC
SH3 539 605 7.82e-10 SMART
GuKc 661 840 2.6e-73 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208377
Predicted Effect probably damaging
Transcript: ENSMUST00000231777
AA Change: T800A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. The encoded protein forms a heterodimer with a related family member that may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described, but their full-length nature is not known. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display lower surface expression of NMDA receptor (NMDAR) subunits NR2A and NR2B in dorsal horn neurons and significantly reduced NMDAR-mediated excitatory synaptic currents and NMDAR-dependent persistent inflammatory or nerve injury-induced neuropathic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Adamts6 A G 13: 104,352,815 D392G possibly damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Alkbh8 A G 9: 3,385,318 K537E probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Bpifb4 A T 2: 153,943,992 I17F probably damaging Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Ccdc88b T A 19: 6,857,740 T38S unknown Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Cdr2 G A 7: 120,958,745 Q186* probably null Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cntnap3 G A 13: 64,761,978 T771I possibly damaging Het
Cops8 C T 1: 90,606,620 probably benign Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Ddx50 A G 10: 62,647,030 S87P probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epha6 A T 16: 59,775,570 D919E probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fndc9 C T 11: 46,237,714 S20L probably benign Het
Gpx6 A G 13: 21,317,643 E145G probably damaging Het
Hc A G 2: 35,057,434 Y23H probably damaging Het
Jmy G T 13: 93,441,396 Q755K probably benign Het
Krtap4-7 A T 11: 99,643,714 S108T unknown Het
Mgat5b T G 11: 116,948,657 I333S probably benign Het
Mkl2 A G 16: 13,401,013 T519A probably damaging Het
Naip6 G A 13: 100,300,077 A646V probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Olfr936 G T 9: 39,046,703 P239T probably damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otogl T A 10: 107,808,756 M1210L probably benign Het
Phf24 A T 4: 42,933,831 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Rad50 A G 11: 53,695,281 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
St5 A G 7: 109,556,905 S213P probably damaging Het
Tbcd C A 11: 121,560,743 N546K probably damaging Het
Tenm4 A G 7: 96,888,827 D1832G probably damaging Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ube2o A T 11: 116,548,807 I179N possibly damaging Het
Usp17le T C 7: 104,769,234 I234V probably damaging Het
Zfp106 T C 2: 120,534,781 T382A probably benign Het
Zfp607a A G 7: 27,879,319 K605E possibly damaging Het
Zmynd10 T A 9: 107,550,586 L363H possibly damaging Het
Other mutations in Dlg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Dlg2 APN 7 91965645 missense probably damaging 1.00
IGL01111:Dlg2 APN 7 91449763 missense possibly damaging 0.84
IGL01122:Dlg2 APN 7 92442608 missense possibly damaging 0.58
IGL01296:Dlg2 APN 7 91940059 missense probably damaging 1.00
IGL02063:Dlg2 APN 7 91810476 splice site probably benign
IGL02233:Dlg2 APN 7 92444538 missense probably damaging 1.00
IGL02519:Dlg2 APN 7 91940115 missense possibly damaging 0.54
IGL02833:Dlg2 APN 7 92431127 missense probably damaging 1.00
IGL03166:Dlg2 APN 7 91900730 splice site probably benign
R0932:Dlg2 UTSW 7 92375637 missense probably damaging 1.00
R1129:Dlg2 UTSW 7 92431174 splice site probably null
R1245:Dlg2 UTSW 7 92442595 splice site probably benign
R1319:Dlg2 UTSW 7 92438023 missense probably damaging 0.98
R1464:Dlg2 UTSW 7 91968198 missense probably damaging 1.00
R1464:Dlg2 UTSW 7 91968198 missense probably damaging 1.00
R1596:Dlg2 UTSW 7 92431051 missense probably damaging 0.99
R1650:Dlg2 UTSW 7 92431051 missense probably damaging 0.99
R1868:Dlg2 UTSW 7 92386952 nonsense probably null
R2006:Dlg2 UTSW 7 91965617 missense possibly damaging 0.95
R2026:Dlg2 UTSW 7 91965723 missense probably damaging 1.00
R2281:Dlg2 UTSW 7 92438041 missense probably damaging 1.00
R3721:Dlg2 UTSW 7 91711800 critical splice donor site probably null
R3722:Dlg2 UTSW 7 91711800 critical splice donor site probably null
R3793:Dlg2 UTSW 7 91810535 splice site probably benign
R4120:Dlg2 UTSW 7 91965638 missense probably damaging 1.00
R4444:Dlg2 UTSW 7 92088593 missense probably damaging 1.00
R4631:Dlg2 UTSW 7 92088614 missense probably damaging 1.00
R4672:Dlg2 UTSW 7 92286535 missense probably damaging 1.00
R4678:Dlg2 UTSW 7 92428580 missense possibly damaging 0.89
R4695:Dlg2 UTSW 7 92437962 splice site probably null
R5106:Dlg2 UTSW 7 92442686 missense probably damaging 0.99
R5355:Dlg2 UTSW 7 91449803 missense probably benign 0.41
R5385:Dlg2 UTSW 7 92088576 missense probably damaging 0.96
R5504:Dlg2 UTSW 7 92442657 missense probably damaging 1.00
R5569:Dlg2 UTSW 7 91968180 missense probably benign 0.01
R5573:Dlg2 UTSW 7 91997324 splice site probably null
R5848:Dlg2 UTSW 7 92444527 missense probably benign 0.41
R5863:Dlg2 UTSW 7 91711779 missense probably benign 0.01
R5907:Dlg2 UTSW 7 91997371 intron probably benign
R6455:Dlg2 UTSW 7 92444508 splice site probably null
R6486:Dlg2 UTSW 7 91872374 critical splice acceptor site probably null
R6817:Dlg2 UTSW 7 91965664 missense probably benign 0.07
R7082:Dlg2 UTSW 7 90731984 missense probably benign
R7808:Dlg2 UTSW 7 92431055 missense probably benign 0.01
R7818:Dlg2 UTSW 7 91940017 missense probably damaging 0.99
R7908:Dlg2 UTSW 7 91900773 missense probably damaging 1.00
R7989:Dlg2 UTSW 7 91900773 missense probably damaging 1.00
RF004:Dlg2 UTSW 7 90852677 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACACCTGAAACAAGTTAGCTC -3'
(R):5'- GGCAAACGTACCCTTTCTGC -3'

Sequencing Primer
(F):5'- ACAAGTTAGCTCGTGTATTTTGTCC -3'
(R):5'- TCTGCTACAAATCTCACAGATTGC -3'
Posted On2016-09-06